RNF175 cdna clone
RNF175 cDNA Clone
Synonyms
RNF175; RNF175 cDNA Clone; RNF175 cdna clone
Sequence
atggccgcggggacggcggcgcggaaggcagcgccggtgctggaggcccccccgcagcaggagcagctctctcatacaaagctttctgcagaagacacatggaacctgcagcaggagaggatgtacaagatgcaccggggccacgattccatgcacgtggaaatgatcttgatcttcctctgcgttctggtcattgcccagatagtgctggttcagtggagacagaggcatggccgatcctacaatctggtgaccttgttgcagatgtgggttgtccccttatatttcacgataaaattatactggtggcggtttctgtctatgtgggggatgttctccgttattaccagttacatcctcttcagagctacccgaaaacccctctcaggaaggacaccacgattggtctacaaatggtttcttttgatctacaaactcagctatgcatttggtgttgtgggttacttggcgatcatgtttacaatgtgtggattcaatctgtttttcaaaatcaaagctagagattccatggattttggcattgtgtctttgttctacggcctctactatggagtaatggggagagactttgccgagatctgctcagactacatggcttccactatagggttctacagtgtcagccggttgcctacaaggagcttatcggacaatatctgtgcagtctgtgggcagaagatcattgtggagcttgatgaagaagggctcattgaaaacacctaccagctttcctgtaatcatgtctttcatgaattctgcatccgaggttggtgtatcgttgggaaaaagcagacttgcccttactgcaaagagaaagttgatttgaagaggatgatcagtaatccctgggagcgcacacattttctgtatggacaaatcctggattggcttcgttatttggtggcctggcaacctgtggtgataggaatagttcaaggcattaactattcactagggctggaatag
Sequence Length
987
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
20,321 Da
NCBI Official Full Name
Homo sapiens ring finger protein 175, mRNA
NCBI Official Synonym Full Names
ring finger protein 175
NCBI Official Symbol
RNF175
NCBI Protein Information
RING finger protein 175
UniProt Protein Name
RING finger protein 175
Protein Family
UniProt Gene Name
RNF175
UniProt Entry Name
RN175_HUMAN
Uniprot Description
RNF175: 2 isoforms of the human protein are produced by alternative splicing
Protein type: Ubiquitin conjugating system; Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 4q31.3
Cellular Component: endoplasmic reticulum membrane; Golgi membrane
Molecular Function: protein binding
Biological Process: ER-associated protein catabolic process; unfolded protein response
Research Articles on RNF175
1. Observational study of gene-disease association and gene-environment interaction. (HuGE Navigator)
Similar Products
Product Notes
The RNF175 rnf175 (Catalog #AAA1274456) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcgg ggacggcggc gcggaaggca gcgccggtgc tggaggcccc cccgcagcag gagcagctct ctcatacaaa gctttctgca gaagacacat ggaacctgca gcaggagagg atgtacaaga tgcaccgggg ccacgattcc atgcacgtgg aaatgatctt gatcttcctc tgcgttctgg tcattgccca gatagtgctg gttcagtgga gacagaggca tggccgatcc tacaatctgg tgaccttgtt gcagatgtgg gttgtcccct tatatttcac gataaaatta tactggtggc ggtttctgtc tatgtggggg atgttctccg ttattaccag ttacatcctc ttcagagcta cccgaaaacc cctctcagga aggacaccac gattggtcta caaatggttt cttttgatct acaaactcag ctatgcattt ggtgttgtgg gttacttggc gatcatgttt acaatgtgtg gattcaatct gtttttcaaa atcaaagcta gagattccat ggattttggc attgtgtctt tgttctacgg cctctactat ggagtaatgg ggagagactt tgccgagatc tgctcagact acatggcttc cactataggg ttctacagtg tcagccggtt gcctacaagg agcttatcgg acaatatctg tgcagtctgt gggcagaaga tcattgtgga gcttgatgaa gaagggctca ttgaaaacac ctaccagctt tcctgtaatc atgtctttca tgaattctgc atccgaggtt ggtgtatcgt tgggaaaaag cagacttgcc cttactgcaa agagaaagtt gatttgaaga ggatgatcag taatccctgg gagcgcacac attttctgta tggacaaatc ctggattggc ttcgttattt ggtggcctgg caacctgtgg tgataggaat agttcaaggc attaactatt cactagggct ggaatag. It is sometimes possible for the material contained within the vial of "RNF175, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
