Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF170 cdna clone

RNF170 cDNA Clone

Gene Names
RNF170; ADSA; SNAX1
Synonyms
RNF170; RNF170 cDNA Clone; RNF170 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaaatatcaaggtgaagttcaaagtttgaaactggatgatgattcagttatagaaggagtaagcgaccaagtacttgtggcagttgtggtcagtttcgctttgattgctaccctggtatatgcacttttcagaaatgtacatcaaaacattcacccagaaaaccaggagctagtaagggtacttcgagaacagcttcaaacagaacaggatgcacctgctgccactcgacagcagttctacactgacatgtactgtcccatctgcctgcaccaagcctccttcccggtggagaccaactgtggacatcttttttgtggtaaccttactcctaacagtatttggtga
Sequence Length
351
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,331 Da
NCBI Official Full Name
Homo sapiens ring finger protein 170, mRNA
NCBI Official Synonym Full Names
ring finger protein 170
NCBI Official Symbol
RNF170
NCBI Official Synonym Symbols
ADSA; SNAX1
NCBI Protein Information
E3 ubiquitin-protein ligase RNF170
UniProt Protein Name
E3 ubiquitin-protein ligase RNF170
UniProt Gene Name
RNF170
UniProt Entry Name
RN170_HUMAN

NCBI Description

This gene encodes a RING domain-containing protein that resides in the endoplasmic reticulum (ER) membrane. This protein functions as an E3 ubiquitin ligase and mediates ubiquitination and processing of inositol 1,4,5-trisphosphate (IP3) receptors via the ER-associated protein degradation pathway. It is recruited to the activated IP3 receptors by the ERLIN1/ERLIN2 complex to which it is constitutively bound. Mutations in this gene are associated with autosomal dominant sensory ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]

Uniprot Description

RNF170: E3 ubiquitin-protein ligase that plays an essential role in stimulus-induced inositol 1,4,5-trisphosphate receptor type 1 (ITPR1) ubiquitination and degradation via the endoplasmic reticulum-associated degradation (ERAD) pathway. Also involved in ITPR1 turnover in resting cells. Defects in RNF170 are the cause of ataxia, sensory, type 1, autosomal dominant (SNAX1). A rare disease characterized by progressive ataxia caused by degeneration of the posterior columns of the spinal cord. Affected individuals have a reduced ability to feel pain, temperature and vibration, particularly in the hands and feet. Their most prominent feature is an ataxic gait resulting from a severe loss of proprioception. Thus, patients rely on visual cues for maintaining proper body posture, such that they are unable to remain upright if their eyes are closed (Romberg sign). 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 8p11.21

Molecular Function: protein binding

Disease: Ataxia, Sensory, 1, Autosomal Dominant

Research Articles on RNF170

Similar Products

Product Notes

The RNF170 rnf170 (Catalog #AAA1267342) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaaat atcaaggtga agttcaaagt ttgaaactgg atgatgattc agttatagaa ggagtaagcg accaagtact tgtggcagtt gtggtcagtt tcgctttgat tgctaccctg gtatatgcac ttttcagaaa tgtacatcaa aacattcacc cagaaaacca ggagctagta agggtacttc gagaacagct tcaaacagaa caggatgcac ctgctgccac tcgacagcag ttctacactg acatgtactg tcccatctgc ctgcaccaag cctccttccc ggtggagacc aactgtggac atcttttttg tggtaacctt actcctaaca gtatttggtg a. It is sometimes possible for the material contained within the vial of "RNF170, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.