Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF146 cdna clone

RNF146 cDNA Clone

Synonyms
RNF146; RNF146 cDNA Clone; RNF146 cdna clone
Ordering
For Research Use Only!
Sequence
atggctggctgtggtgaaattgatcattcaataaacatgcttcctacaaacaggaaagcgaacgagtcctgttctaatactgcaccttctttaaccgtccctgaatgtgccatttgtctgcaaacatgtgttcatccagtcagtctgccctgtaagcacgttttctgctatctatgtgtaaaaggagcttcatggcttggaaagcggtgtgctctttgtcgacaagaaattcccgaggatttccttgacaagccaaccttgttgtcaccagaagaactcaaggcagcaagtagaggaaatggtgaatatgcatggtattatgaaggaagaaatgggtggtggcagtacgatgagcgcactagtagagagctggaagatgctttttccaaaggtaaaaagaacactgaaatgttaattgctggctttctgtatgtcgctgatcttgaaaacatggttcaatataggagaaatgaacatggacgtcgcaggaagattaagcgagatataatagatataccaaagaagggagtagctggacttaggctagactgtgatgctaataccgtaaacctagcaagagagagctctgctgacggagcggacagtgtatcagcacagagtggagcttctgttcagcccctagtgtcttctgtaaggcccctaacatcagtagatggtcagttaacaagccctgcaacaccatcccctgatgcaagcacttctctggaagactcttttgctcatttacaactcagtggagacaacacagctgaaaggagtcataggggagaaggagaagaagatcatgaatcaccatcttcaggcagggtaccagcaccagacacctccattgaagaaactgaatcagatgccagtagtgatagtgaggatgtatctgcagttgttgcacagcactccttgacccaacagagacttttggtttctaatgcaaaccagacagtacccgatcgatcagatcgatcgggaactgatcgatcagtagcagggggtggaacagtgagtgtcagtgtcagatctagaaggcctgatggacagtgcacagtaactgaagtttaa
Sequence Length
1077
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,819 Da
NCBI Official Full Name
Homo sapiens ring finger protein 146, mRNA
NCBI Official Synonym Full Names
ring finger protein 146
NCBI Official Symbol
RNF146
NCBI Protein Information
E3 ubiquitin-protein ligase RNF146
UniProt Protein Name
E3 ubiquitin-protein ligase RNF146
UniProt Gene Name
RNF146
UniProt Entry Name
RN146_HUMAN

Uniprot Description

RNF146: E3 ubiquitin-protein ligase that specifically binds poly-ADP-ribosylated (PARsylated) proteins and mediates their ubiquitination and subsequent degradation. May regulate many important biological processes, such as cell survival and DNA damage response. Acts as an activator of the Wnt signaling pathway by mediating the ubiquitination of PARsylated AXIN1 and AXIN2, 2 key components of the beta-catenin destruction complex. Acts in cooperation with tankyrase proteins (TNKS and TNKS2), which mediate PARsylation of target proteins AXIN1, AXIN2, BLZF1, CASC3, TNKS and TNKS2. Recognizes and binds tankyrase-dependent PARsylated proteins via its WWE domain and mediates their ubiquitination, leading to their degradation. Different ubiquitin linkage types have been observed: TNKS2 undergoes ubiquination at 'Lys-48' and 'Lys-63', while AXIN1 is only ubiquitinated at 'Lys- 48'. May regulate TNKS and TNKS2 subcellular location, preventing aggregation at a centrosomal location. Neuroprotective protein. Protects the brain against N-methyl-D-aspartate (NMDA) receptor- mediated glutamate excitotoxicity and ischemia, by interfering with PAR-induced cell death, called parthanatos. Prevents nuclear translocation of AIFM1 in a PAR-binding dependent manner. Does not affect PARP1 activation. Protects against cell death induced by DNA damaging agents, such as N-methyl-N-nitro-N- nitrosoguanidine (MNNG) and rescues cells from G1 arrest. Promotes cell survival after gamma-irradiation. Facilitates DNA repair. Defects in RNF146 are a cause of susceptibility to breast cancer. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; Ubiquitin conjugating system; EC 6.3.2.19; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 6q22.1-q22.33

Cellular Component: cytosol

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: protein autoubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; Wnt receptor signaling pathway

Research Articles on RNF146

Similar Products

Product Notes

The RNF146 rnf146 (Catalog #AAA1273798) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggct gtggtgaaat tgatcattca ataaacatgc ttcctacaaa caggaaagcg aacgagtcct gttctaatac tgcaccttct ttaaccgtcc ctgaatgtgc catttgtctg caaacatgtg ttcatccagt cagtctgccc tgtaagcacg ttttctgcta tctatgtgta aaaggagctt catggcttgg aaagcggtgt gctctttgtc gacaagaaat tcccgaggat ttccttgaca agccaacctt gttgtcacca gaagaactca aggcagcaag tagaggaaat ggtgaatatg catggtatta tgaaggaaga aatgggtggt ggcagtacga tgagcgcact agtagagagc tggaagatgc tttttccaaa ggtaaaaaga acactgaaat gttaattgct ggctttctgt atgtcgctga tcttgaaaac atggttcaat ataggagaaa tgaacatgga cgtcgcagga agattaagcg agatataata gatataccaa agaagggagt agctggactt aggctagact gtgatgctaa taccgtaaac ctagcaagag agagctctgc tgacggagcg gacagtgtat cagcacagag tggagcttct gttcagcccc tagtgtcttc tgtaaggccc ctaacatcag tagatggtca gttaacaagc cctgcaacac catcccctga tgcaagcact tctctggaag actcttttgc tcatttacaa ctcagtggag acaacacagc tgaaaggagt cataggggag aaggagaaga agatcatgaa tcaccatctt caggcagggt accagcacca gacacctcca ttgaagaaac tgaatcagat gccagtagtg atagtgagga tgtatctgca gttgttgcac agcactcctt gacccaacag agacttttgg tttctaatgc aaaccagaca gtacccgatc gatcagatcg atcgggaact gatcgatcag tagcaggggg tggaacagtg agtgtcagtg tcagatctag aaggcctgat ggacagtgca cagtaactga agtttaa. It is sometimes possible for the material contained within the vial of "RNF146, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.