RNF145 cdna clone
RNF145 cDNA Clone
Synonyms
RNF145; RNF145 cDNA Clone; RNF145 cdna clone
Sequence
atggctgcaaaggagaaactggaggtagtgttaaatgtggccctgagggtgccaagcatcatgctgttggatgtcctgtacagatgggatgtcagctcctttttccagcagatccaaagaagtagccttagtaataaccctcttttccagtataagtatttggctcttaatatgcattatgtaggttatatcttaagtgtggtgctgctaacattgcccaggcagcatctggttcagctttatctatattttttgactgctctgctcctctatgctggacatcaaatttccagggactatgttcggagtgaactggagtttgcctatgagggaccaatgtatttagaacctctctctatgaatcggtttaccacagccttaataggtcagttggtggtgtgtactttatgctcctgtgtcatgaaaacaaagcagatttggctgttttcagctcacatgcttcctctgctagcacgactctgccttgttcctttggagacaattgttatcatcaataaatttgctatgatttttactggattggaagttctctattttcttgggtctaatcttttggtaccttataaccttgctaaatctgcatacagagaattggttcaggtagtggaggtatatggccttctcgccttgggaatgtccctgtggaatcaactggtagtccctgttcttttcatggttttctggctcgtcttatttgctcttcagatttactcctatttcagtactcgagatcagcctgcatcacgtgagaggcttcttttcctttttctgacaagtattgcggaatgctgcagcactccttactctcttttgggtttggtcttcacggtttcttttgttgccttgggtgttctcacactctgcaagttttacttgcagggttatcgagctttcatgaatgatcctgccatgaatcggggcatgacagaaggagtaacgctgttaatcctggcagtgcagactgggctgatagaactgcaggttgttcatcgggcattcttgctcagtattatccttttcattgtcgtagcttctatcctacagtctatgttagaaattgcagatcctattgttttggcactgggagcatctagagacaagagcttgtggaaacacttccgtgctgcaagcctttgtttatttttattggtattccctgcttatatggcttatatgatttgccagtttttccacatggatttttggcttcttatcattatttccagcagcattcttacctctcttcaggttctgggaacactttttatttatgtcttatttatggttgaggaattcagaaaagagccagtggaaaacatggatgatgtcatctactatgtgaatggcacttaccgcctgctggagtttcttgtggccctctgtgtggtggcctatggcgtctcagagaccatctttggagaatggacagtgatgggctcaatgatcatcttcattcattcctactataacgtgtggcttcgggcccagctggggtggaagagctttcttctccgcagggatgctgtgaataagattaaatcgttacccattgctacgaaagagcagcttgagaaacacaatgatatttgtgccatctgttatcaggacatgaaatctgctgtgatcacgccttgcagtcattttttccatgcaggctgtcttaagaaatggctgtatgtccaggagacctgccctctgtgccactgccatctgaaaaactcctcccagcttccaggattaggaactgagccagttctacagcctcatgctggagctgagcaaaacgtcatgtttcaggaaggtactgaacccccaggccaggagcatactccagggaccaggatacaggaaggttccagggacaataatgagtacattgccagacgaccagataaccaggaaggggcttttgaccccaaagaatatcctcacagtgcgaaagatgaagtacatcctgttgaatcagcctag
Sequence Length
1992
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
79,198 Da
NCBI Official Full Name
Homo sapiens ring finger protein 145, mRNA
NCBI Official Synonym Full Names
ring finger protein 145
NCBI Official Symbol
RNF145
NCBI Protein Information
RING finger protein 145
UniProt Protein Name
RING finger protein 145
Protein Family
UniProt Gene Name
RNF145
UniProt Entry Name
RN145_HUMAN
Uniprot Description
RNF145: 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Motility/polarity/chemotaxis; Membrane protein, integral; Ubiquitin conjugating system; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 5q33.3
Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process
Similar Products
Product Notes
The RNF145 rnf145 (Catalog #AAA1275126) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcaa aggagaaact ggaggtagtg ttaaatgtgg ccctgagggt gccaagcatc atgctgttgg atgtcctgta cagatgggat gtcagctcct ttttccagca gatccaaaga agtagcctta gtaataaccc tcttttccag tataagtatt tggctcttaa tatgcattat gtaggttata tcttaagtgt ggtgctgcta acattgccca ggcagcatct ggttcagctt tatctatatt ttttgactgc tctgctcctc tatgctggac atcaaatttc cagggactat gttcggagtg aactggagtt tgcctatgag ggaccaatgt atttagaacc tctctctatg aatcggttta ccacagcctt aataggtcag ttggtggtgt gtactttatg ctcctgtgtc atgaaaacaa agcagatttg gctgttttca gctcacatgc ttcctctgct agcacgactc tgccttgttc ctttggagac aattgttatc atcaataaat ttgctatgat ttttactgga ttggaagttc tctattttct tgggtctaat cttttggtac cttataacct tgctaaatct gcatacagag aattggttca ggtagtggag gtatatggcc ttctcgcctt gggaatgtcc ctgtggaatc aactggtagt ccctgttctt ttcatggttt tctggctcgt cttatttgct cttcagattt actcctattt cagtactcga gatcagcctg catcacgtga gaggcttctt ttcctttttc tgacaagtat tgcggaatgc tgcagcactc cttactctct tttgggtttg gtcttcacgg tttcttttgt tgccttgggt gttctcacac tctgcaagtt ttacttgcag ggttatcgag ctttcatgaa tgatcctgcc atgaatcggg gcatgacaga aggagtaacg ctgttaatcc tggcagtgca gactgggctg atagaactgc aggttgttca tcgggcattc ttgctcagta ttatcctttt cattgtcgta gcttctatcc tacagtctat gttagaaatt gcagatccta ttgttttggc actgggagca tctagagaca agagcttgtg gaaacacttc cgtgctgcaa gcctttgttt atttttattg gtattccctg cttatatggc ttatatgatt tgccagtttt tccacatgga tttttggctt cttatcatta tttccagcag cattcttacc tctcttcagg ttctgggaac actttttatt tatgtcttat ttatggttga ggaattcaga aaagagccag tggaaaacat ggatgatgtc atctactatg tgaatggcac ttaccgcctg ctggagtttc ttgtggccct ctgtgtggtg gcctatggcg tctcagagac catctttgga gaatggacag tgatgggctc aatgatcatc ttcattcatt cctactataa cgtgtggctt cgggcccagc tggggtggaa gagctttctt ctccgcaggg atgctgtgaa taagattaaa tcgttaccca ttgctacgaa agagcagctt gagaaacaca atgatatttg tgccatctgt tatcaggaca tgaaatctgc tgtgatcacg ccttgcagtc attttttcca tgcaggctgt cttaagaaat ggctgtatgt ccaggagacc tgccctctgt gccactgcca tctgaaaaac tcctcccagc ttccaggatt aggaactgag ccagttctac agcctcatgc tggagctgag caaaacgtca tgtttcagga aggtactgaa cccccaggcc aggagcatac tccagggacc aggatacagg aaggttccag ggacaataat gagtacattg ccagacgacc agataaccag gaaggggctt ttgaccccaa agaatatcct cacagtgcga aagatgaagt acatcctgtt gaatcagcct ag. It is sometimes possible for the material contained within the vial of "RNF145, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
