Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RIPK3 cdna clone

RIPK3 cDNA Clone

Gene Names
RIPK3; RIP3
Synonyms
RIPK3; RIPK3 cDNA Clone; RIPK3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgtgcgtcaagttatggcccagcggtgcccccgcccccttggtgtccatcgaggaactggagaaccaggagctcgtcggcaaaggcgggttcggcacagtgttccgggcgcaacataggaagtggggctacgatgtggcggtcaagatcgtaaactcgaaggcgatatccagggaggtcaaggccatggcaagtctggataacgaattcgtgctgcgcctagaaggggttatcgagaaggtgaactgggaccaagatcccaagccggctctggtgactaaattcatggagaacggctccttgtcggggctgctgcagtcccagtgccctcggccctggccgctcctttgccgcctgctgaaagaagtggtgcttgggatgttttacctgcaccgggacctcaagccatccaacgtcctgctggacccagagctgcacgtcaaggtcagctggtctacacccctctcagcctcaagacaaggccccagagctgctccagccaggcccgccggacactag
Sequence Length
522
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,326 Da
NCBI Official Full Name
Homo sapiens receptor-interacting serine-threonine kinase 3, mRNA
NCBI Official Synonym Full Names
receptor interacting serine/threonine kinase 3
NCBI Official Symbol
RIPK3
NCBI Official Synonym Symbols
RIP3
NCBI Protein Information
receptor-interacting serine/threonine-protein kinase 3
UniProt Protein Name
Receptor-interacting serine/threonine-protein kinase 3
UniProt Gene Name
RIPK3
UniProt Synonym Gene Names
RIP3; RIP-3
UniProt Entry Name
RIPK3_HUMAN

NCBI Description

The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]

Uniprot Description

RIPK3: Promotes apoptosis. Belongs to the protein kinase superfamily. TKL Ser/Thr protein kinase family. Binds TRAF2 and RIPK1 and is recruited to the TNFR-1 signaling complex. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, TKL; Kinase, protein; EC 2.7.11.1; Protein kinase, Ser/Thr (non-receptor); TKL group; RIPK family

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: cytosol

Molecular Function: identical protein binding; protein binding; protein complex binding; protein kinase activity; protein serine/threonine kinase activity; transcription coactivator activity

Biological Process: activation of NF-kappaB transcription factor; activation of protein kinase activity; lymph node development; protein amino acid autophosphorylation; protein heterooligomerization; protein homooligomerization; protein modification process; regulation of activated T cell proliferation; regulation of adaptive immune response; regulation of interferon-gamma production; regulation of T cell mediated cytotoxicity; signal transduction; spleen development; T cell differentiation in the thymus; T cell homeostasis; thymus development

Research Articles on RIPK3

Similar Products

Product Notes

The RIPK3 ripk3 (Catalog #AAA1269211) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtgcg tcaagttatg gcccagcggt gcccccgccc ccttggtgtc catcgaggaa ctggagaacc aggagctcgt cggcaaaggc gggttcggca cagtgttccg ggcgcaacat aggaagtggg gctacgatgt ggcggtcaag atcgtaaact cgaaggcgat atccagggag gtcaaggcca tggcaagtct ggataacgaa ttcgtgctgc gcctagaagg ggttatcgag aaggtgaact gggaccaaga tcccaagccg gctctggtga ctaaattcat ggagaacggc tccttgtcgg ggctgctgca gtcccagtgc cctcggccct ggccgctcct ttgccgcctg ctgaaagaag tggtgcttgg gatgttttac ctgcaccggg acctcaagcc atccaacgtc ctgctggacc cagagctgca cgtcaaggtc agctggtcta cacccctctc agcctcaaga caaggcccca gagctgctcc agccaggccc gccggacact ag. It is sometimes possible for the material contained within the vial of "RIPK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.