Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RINT1 cdna clone

RINT1 cDNA Clone

Gene Names
RINT1; RINT-1
Synonyms
RINT1; RINT1 cDNA Clone; RINT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctaccagccggcgagatcggcgcctctcctgcagccccgtgctgctctgaaagtggtgacgaaaggaagaacctcgaggagaaaagtgacataaatgttacagttcttattggaagtaaacaagtcagtgaaggtacagataatggtgatctcccttcttatgtgtctgcattcatagaaaaggaagttggaaatgaccttaaatctttaaagaaacttgataaactcatagaacagaggacagtaagtaaaatgcagttagaagaacaggtacttacaatttcatcagaaattcctaaaagaattcgaagtgccttaaaaaatgcagaagaatcaaagcaatttcttaatcagtttctggagcaggaaactcatctcttcagcgccattaacagccatttgctgactgcgcaaccttggatggacgatcttggaaccatgattagccagattgaagagatcgaacgtcatcttgcttaccttaaatggatttcacaaattgaagaactaagtgataacattcagcaatatctgatgaccaataatgtaccggaggcagcctccactctagtgtctatggcagaacttgacattaaacttcaggaatcatcttgtactcatcttcttggtttcatgagagccacagttaaattctggcataaaattctcaaggacaagcttacaagtgattttgaggaaattttagcacagcttcattggccattcatcgcaccccctcaatcacaaactgttggcttaagtcgacctgccagtgccccggagatatacagttacctggagacactgttttgtcagcttttgaaactacaaacctcagatgaattacttactgagccaaagcaactcccagaaaaatactctcttcctgcctccccttctgtcatcctgcccatccaggttatgctgactcctcttcagaagaggttcaggtatcacttcagagggaaccggcagactaatgtgttaagcaagccagaatggtacttggctcaagtacttatgtggattggaaaccatactgaatttctggatgagaagattcagccaatattagacaaagtaggctctttggtaaacgcaaggcttgaattttctcggggccttatgatgctggttcttgagaagttagccactgatattccttgtctgctatatgatgacaatctcttctgtcatttggtggatgaagtactcttgtttgaaagggagctacacagtgttcatggctatcctggcacttttgctagttgtatgcatattctatcagaggaaacctgttttcagagatggttgacggtggagagaaaatttgctcttcaaaaaatggactcaatgctttcctcagaagctgcctgggtatcgcaatataaggatatcactgacgtggatgaaatgaaagttccagattgtgcagaaacttttatgactctactcttggttataactgacaggtataaaaatcttcccacagcttcccgaaagcttcagttcctggagttacagaaggacttagtagatgattttaggatacgattaacacaagtgatgaaagaagagactagagcttcccttggctttcgatactgtgcaattcttaatgctgtgaactacatctcaacagtactagcagattgggctgacaatgttttctttctacaacttcaacaggctgcactggaggtgtttgcagagaataatactctgagtaaattgcagctaggacagctagcctctatggagagctctgtctttgatgacatgattaacctcttagaacgtttaaagcatgatatgttgacccgtcaagtagaccacgtttttagagaagttaaagatgctgcaaaattgtataaaaaagaaagatggttgtccttgccatctcagtcagagcaggcagtgatgtccctgtccagttcggcttgcccgttgctgctgacgttacgagaccatttacttcagttggagcagcagctttgtttctccttatttaaaattttctggcaaatgcttgtagagaagctggatgtatacatctaccaagaaataattcttgctaatcacttcaatgaaggaggagcagcccagctgcagtttgatatgactcggaatcttttccctttgttttctcactattgcaagagaccagaaaattattttaaacatataaaagaagcctgtattgttttgaatttgaacgtcggttctgcactactgctgaaagatgtactgcagtcagcttcagggcagcttcctgccacagcagcattaaatgaagttggaatttacaaactggctcaacaagatgttgagattctacttaatttgaggacaaattggcctaatactggaaaataa
Sequence Length
2379
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,632 Da
NCBI Official Full Name
Homo sapiens RAD50 interactor 1, mRNA
NCBI Official Synonym Full Names
RAD50 interactor 1
NCBI Official Symbol
RINT1
NCBI Official Synonym Symbols
RINT-1
NCBI Protein Information
RAD50-interacting protein 1
UniProt Protein Name
RAD50-interacting protein 1
Protein Family
UniProt Gene Name
RINT1
UniProt Synonym Gene Names
HsRINT-1; RINT-1
UniProt Entry Name
RINT1_HUMAN

Uniprot Description

RINT1: Involved in regulation of membrane traffic between the Golgi and the endoplasmic reticulum. May play a role in cell cycle checkpoint control. Essential for telomere length control. Belongs to the RINT1 family.

Chromosomal Location of Human Ortholog: 7q22.3

Cellular Component: cytosol; endoplasmic reticulum

Molecular Function: protein binding

Biological Process: retrograde vesicle-mediated transport, Golgi to ER

Research Articles on RINT1

Similar Products

Product Notes

The RINT1 rint1 (Catalog #AAA1272407) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctaccag ccggcgagat cggcgcctct cctgcagccc cgtgctgctc tgaaagtggt gacgaaagga agaacctcga ggagaaaagt gacataaatg ttacagttct tattggaagt aaacaagtca gtgaaggtac agataatggt gatctccctt cttatgtgtc tgcattcata gaaaaggaag ttggaaatga ccttaaatct ttaaagaaac ttgataaact catagaacag aggacagtaa gtaaaatgca gttagaagaa caggtactta caatttcatc agaaattcct aaaagaattc gaagtgcctt aaaaaatgca gaagaatcaa agcaatttct taatcagttt ctggagcagg aaactcatct cttcagcgcc attaacagcc atttgctgac tgcgcaacct tggatggacg atcttggaac catgattagc cagattgaag agatcgaacg tcatcttgct taccttaaat ggatttcaca aattgaagaa ctaagtgata acattcagca atatctgatg accaataatg taccggaggc agcctccact ctagtgtcta tggcagaact tgacattaaa cttcaggaat catcttgtac tcatcttctt ggtttcatga gagccacagt taaattctgg cataaaattc tcaaggacaa gcttacaagt gattttgagg aaattttagc acagcttcat tggccattca tcgcaccccc tcaatcacaa actgttggct taagtcgacc tgccagtgcc ccggagatat acagttacct ggagacactg ttttgtcagc ttttgaaact acaaacctca gatgaattac ttactgagcc aaagcaactc ccagaaaaat actctcttcc tgcctcccct tctgtcatcc tgcccatcca ggttatgctg actcctcttc agaagaggtt caggtatcac ttcagaggga accggcagac taatgtgtta agcaagccag aatggtactt ggctcaagta cttatgtgga ttggaaacca tactgaattt ctggatgaga agattcagcc aatattagac aaagtaggct ctttggtaaa cgcaaggctt gaattttctc ggggccttat gatgctggtt cttgagaagt tagccactga tattccttgt ctgctatatg atgacaatct cttctgtcat ttggtggatg aagtactctt gtttgaaagg gagctacaca gtgttcatgg ctatcctggc acttttgcta gttgtatgca tattctatca gaggaaacct gttttcagag atggttgacg gtggagagaa aatttgctct tcaaaaaatg gactcaatgc tttcctcaga agctgcctgg gtatcgcaat ataaggatat cactgacgtg gatgaaatga aagttccaga ttgtgcagaa acttttatga ctctactctt ggttataact gacaggtata aaaatcttcc cacagcttcc cgaaagcttc agttcctgga gttacagaag gacttagtag atgattttag gatacgatta acacaagtga tgaaagaaga gactagagct tcccttggct ttcgatactg tgcaattctt aatgctgtga actacatctc aacagtacta gcagattggg ctgacaatgt tttctttcta caacttcaac aggctgcact ggaggtgttt gcagagaata atactctgag taaattgcag ctaggacagc tagcctctat ggagagctct gtctttgatg acatgattaa cctcttagaa cgtttaaagc atgatatgtt gacccgtcaa gtagaccacg tttttagaga agttaaagat gctgcaaaat tgtataaaaa agaaagatgg ttgtccttgc catctcagtc agagcaggca gtgatgtccc tgtccagttc ggcttgcccg ttgctgctga cgttacgaga ccatttactt cagttggagc agcagctttg tttctcctta tttaaaattt tctggcaaat gcttgtagag aagctggatg tatacatcta ccaagaaata attcttgcta atcacttcaa tgaaggagga gcagcccagc tgcagtttga tatgactcgg aatcttttcc ctttgttttc tcactattgc aagagaccag aaaattattt taaacatata aaagaagcct gtattgtttt gaatttgaac gtcggttctg cactactgct gaaagatgta ctgcagtcag cttcagggca gcttcctgcc acagcagcat taaatgaagt tggaatttac aaactggctc aacaagatgt tgagattcta cttaatttga ggacaaattg gcctaatact ggaaaataa. It is sometimes possible for the material contained within the vial of "RINT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.