Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RIC8A cdna clone

RIC8A cDNA Clone

Gene Names
RIC8A; RIC8
Synonyms
RIC8A; RIC8A cDNA Clone; RIC8A cdna clone
Ordering
For Research Use Only!
Sequence
atggatgttgtactggagtccctcaagtgcctgtgcaacctcgtgctcagcagccctgtggcacagatgctggcagcagaggcccgcctagtggtgaagctcacagagcgtgtggggctgtaccgtgagaggagcttcccccacgatgtccagttctttgacttgcggctcctcttcctgctaacggcactccgcaccgatgtgcgccagcagctgtttcaggagctgaaaggagtgcgcctgctaactgacacactggagctgacgctgggggtgactcctgaagggaacccacccacgctccttccttcccaagagactgagcgggccatggagatcctcaaagtgctcttcaacatcaccctggactccatcaagggggaggtggacgaggaagacgctgccctttaccgacacctggggacccttctccggcactgtgtgatgatcgctactgctggagaccgcacagaggagttccacggccacgcagtgaacctcctggggaacttgcccctcaagtgtctggatgttctcctcaccctggagccacatggagactccacggagttcatgggagtgaatatggatgtgattcgtgccctcctcatcttcctagagaagcgtttgcacaagacacacaggctgaaggagagtgtagctcccgtgctgagcgtgctgactgaatgtgcccggatgcaccgcccagccaggaagttcctgaaggcccaggtgctgccccctctgcgggatgtgaggacacggcctgaggttggggagatgctgcggaacaagcttgtccgcctcatgacacacctggacacagatgtgaagagggtggctgccgagttcttgtttgtcctgtgctctgagagtgtgccccgattcatcaagtacacaggctatgggaatgctgctggccttctggctgccaggggcctcatggcaggaggccggcccgagggccagtactcagaggatgaggacacagacacagatgagtacaaggaagccaaagccagcataaaccctgtgaccgggagggtggaggagaagccgcctaaccctatggagggcatgacagaggagcagaaggagcacgaggccatgaagctggtgaccatgtttgacaagctctccaggaacagagtcatccagccaatggggatgagtccccggggtcatcttacgtccctgcaggatgccatgtgcgagactatggagcagcagctctcctcggaccctgactcggaccctgactga
Sequence Length
1263
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,612 Da
NCBI Official Full Name
Homo sapiens resistance to inhibitors of cholinesterase 8 homolog A (C. elegans), mRNA
NCBI Official Synonym Full Names
RIC8 guanine nucleotide exchange factor A
NCBI Official Symbol
RIC8A
NCBI Official Synonym Symbols
RIC8
NCBI Protein Information
synembryn-A
UniProt Protein Name
Synembryn-A
Protein Family
UniProt Gene Name
RIC8A
UniProt Entry Name
RIC8A_HUMAN

Uniprot Description

RIC8A: Guanine nucleotide exchange factor (GEF), which can activate some, but not all, G-alpha proteins. Able to activate GNAI1, GNAO1 and GNAQ, but not GNAS by exchanging bound GDP for free GTP. Involved in regulation of microtubule pulling forces during mitotic movement of chromosomes by stimulating G(i)-alpha protein, possibly leading to release G(i)-alpha-GTP and NuMA proteins from the NuMA-GPSM2-G(i)-alpha-GDP complex. Also acts as an activator for G(q)-alpha (GNAQ) protein by enhancing the G(q)-coupled receptor-mediated ERK activation. Belongs to the synembryn family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs, misc.; GEFs

Chromosomal Location of Human Ortholog: 11p15.5

Cellular Component: cytoplasm; plasma membrane

Molecular Function: G-protein alpha-subunit binding; GTPase activator activity; guanyl-nucleotide exchange factor activity; protein binding

Biological Process: G-protein coupled receptor protein signaling pathway

Research Articles on RIC8A

Similar Products

Product Notes

The RIC8A ric8a (Catalog #AAA1276364) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgttg tactggagtc cctcaagtgc ctgtgcaacc tcgtgctcag cagccctgtg gcacagatgc tggcagcaga ggcccgccta gtggtgaagc tcacagagcg tgtggggctg taccgtgaga ggagcttccc ccacgatgtc cagttctttg acttgcggct cctcttcctg ctaacggcac tccgcaccga tgtgcgccag cagctgtttc aggagctgaa aggagtgcgc ctgctaactg acacactgga gctgacgctg ggggtgactc ctgaagggaa cccacccacg ctccttcctt cccaagagac tgagcgggcc atggagatcc tcaaagtgct cttcaacatc accctggact ccatcaaggg ggaggtggac gaggaagacg ctgcccttta ccgacacctg gggacccttc tccggcactg tgtgatgatc gctactgctg gagaccgcac agaggagttc cacggccacg cagtgaacct cctggggaac ttgcccctca agtgtctgga tgttctcctc accctggagc cacatggaga ctccacggag ttcatgggag tgaatatgga tgtgattcgt gccctcctca tcttcctaga gaagcgtttg cacaagacac acaggctgaa ggagagtgta gctcccgtgc tgagcgtgct gactgaatgt gcccggatgc accgcccagc caggaagttc ctgaaggccc aggtgctgcc ccctctgcgg gatgtgagga cacggcctga ggttggggag atgctgcgga acaagcttgt ccgcctcatg acacacctgg acacagatgt gaagagggtg gctgccgagt tcttgtttgt cctgtgctct gagagtgtgc cccgattcat caagtacaca ggctatggga atgctgctgg ccttctggct gccaggggcc tcatggcagg aggccggccc gagggccagt actcagagga tgaggacaca gacacagatg agtacaagga agccaaagcc agcataaacc ctgtgaccgg gagggtggag gagaagccgc ctaaccctat ggagggcatg acagaggagc agaaggagca cgaggccatg aagctggtga ccatgtttga caagctctcc aggaacagag tcatccagcc aatggggatg agtccccggg gtcatcttac gtccctgcag gatgccatgt gcgagactat ggagcagcag ctctcctcgg accctgactc ggaccctgac tga. It is sometimes possible for the material contained within the vial of "RIC8A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.