Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RHBDL2 cdna clone

RHBDL2 cDNA Clone

Gene Names
RHBDL2; RRP2
Synonyms
RHBDL2; RHBDL2 cDNA Clone; RHBDL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatctgaatatggggagagagatgaaagaagagctggaggaagaggagaaaatgagagaggatgggggaggtaaagatcgggccaagagtaaaaaggtccacaggattgtctcaaaatggatgctgcccgaaaagtcccgaggaacatacttggagagagctaactgcttcccgcctcccgtgttcatcatctccatcagcctggccgagctggcagtgtttatttactatgctgtgtggaagcctcagaaacagtggatcacgttggacacaggcatcttggagagtccctttatctacagtcctgagaagagggaggaagcctggaggtttatctcatacatgctggtacatgctgggtaa
Sequence Length
366
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,442 Da
NCBI Official Full Name
Homo sapiens rhomboid, veinlet-like 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
rhomboid like 2
NCBI Official Symbol
RHBDL2
NCBI Official Synonym Symbols
RRP2
NCBI Protein Information
rhomboid-related protein 2
UniProt Protein Name
Rhomboid-related protein 2
UniProt Gene Name
RHBDL2
UniProt Synonym Gene Names
RRP2; NTF; CTF
UniProt Entry Name
RHBL2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]

Uniprot Description

RHBDL2: Involved in regulated intramembrane proteolysis and the subsequent release of functional polypeptides from their membrane anchors. Known substrate: EFNB3. Belongs to the peptidase S54 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; EC 3.4.21.105; Protease; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: integral to membrane; mitochondrial inner membrane; plasma membrane

Molecular Function: serine-type endopeptidase activity

Biological Process: protein processing

Research Articles on RHBDL2

Similar Products

Product Notes

The RHBDL2 rhbdl2 (Catalog #AAA1272646) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatctga atatggggag agagatgaaa gaagagctgg aggaagagga gaaaatgaga gaggatgggg gaggtaaaga tcgggccaag agtaaaaagg tccacaggat tgtctcaaaa tggatgctgc ccgaaaagtc ccgaggaaca tacttggaga gagctaactg cttcccgcct cccgtgttca tcatctccat cagcctggcc gagctggcag tgtttattta ctatgctgtg tggaagcctc agaaacagtg gatcacgttg gacacaggca tcttggagag tccctttatc tacagtcctg agaagaggga ggaagcctgg aggtttatct catacatgct ggtacatgct gggtaa. It is sometimes possible for the material contained within the vial of "RHBDL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.