Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS6 cdna clone

RGS6 cDNA Clone

Gene Names
RGS6; GAP; S914; HA117
Synonyms
RGS6; RGS6 cDNA Clone; RGS6 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcaaggatccggggatcaaagagcagtgggggttgctgacccagaggagagttctccaaacatgatcgtttactgcaaaattgaagacatcattacaaagatgcaagatgacaagacagggggtgtgcccatcagaacagtcaagagctttctctccaaaatccccagtgtcgtcacaggtactgacattgtgcagtggcttatgaagaacctttccattgaggacccagttgaagcaatacacttggggagccttatcgctgcccagggctacatctttccaatctcagaccatgttctcaccatgaaggatgatggcaccttttatcgtttccaggctccgtacttctggccttcgaactgctgggaacctgaaaacactgactatgccatctatctctgtaagaggacaatgcaaaataaagcaaggctggaactggcagattatgaagcagaaaacttagcaagactccagagggcctttgcgaggaagtgggaattcatctttatgcaagcagaagcacaagtaaagattgaccggaaaaaagacaagacagaaaggaaaattttggatagtcaagaacgagccttttgggatgtccacaggcctgtgccaggctgtgtgaacacaacagaaatggatatccgaaaatgtcgacgtttgaagaatccacaaaaggttaaaaagtccgtgtatggcgtgactgaagagtcccaggcacagagcccggtgcatgtactcagccaaccaatcaggaaaacaacaaaagaggacatccggaaacagataacatttttgaacgcacagatcgacagacattgtttgaaaatgtccaaagtggctgaaagtttaattgcctacacggaacaatatgtggaatatgaccctttgataacaccagctgagccatccaacccttggatcagcgatgacgttgctttgtgggacatagagatgagcaaagagcccagccaacagcgagtaaaaagatggggcttctctttcgatgagatattgaaggaccaggtggggcgggaccagtttctacgattcctggagtccgaattcagttcagaaaacctcaggttctggctggctgtccaagatcttaagaaacaacccctacaggatgtggccaagagggtagaagaaatctggcaagagtttctggctccaggggctccaagtgcaatcaacctggattctcacagctatgagataaccagtcaaaatgtcaaagatggagggagatatacatttgaagacgcccaggagcacatctacaagctgatgaagagtgacagctatgcccgcttcctccggtcaaatgcttaccaggatttgctgctggccaagaagaagggaaagtcgctggcgggcaagcgcctcacgggcctgatgcagtcctcctga
Sequence Length
1419
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,319 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 6, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 6
NCBI Official Symbol
RGS6
NCBI Official Synonym Symbols
GAP; S914; HA117
NCBI Protein Information
regulator of G-protein signaling 6
UniProt Protein Name
Regulator of G-protein signaling 6
UniProt Gene Name
RGS6
UniProt Synonym Gene Names
RGS6
UniProt Entry Name
RGS6_HUMAN

NCBI Description

This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP and GGL domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Many alternatively spliced transcript variants encoding different isoforms with long or short N-terminal domains, complete or incomplete GGL domains, and distinct C-terminal domains, have been described for this gene, however, the full-length nature of some of these variants is not known.[provided by RefSeq, Mar 2011]

Uniprot Description

RGS6: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Activity on G(o)-alpha is specifically enhanced by the RGS6/Gbeta5 dimer. 11 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: cytosol; extrinsic to membrane; plasma membrane

Molecular Function: GTPase activator activity; protein binding

Biological Process: positive regulation of GTPase activity; regulation of G-protein coupled receptor protein signaling pathway

Research Articles on RGS6

Similar Products

Product Notes

The RGS6 rgs6 (Catalog #AAA1272383) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcaag gatccgggga tcaaagagca gtgggggttg ctgacccaga ggagagttct ccaaacatga tcgtttactg caaaattgaa gacatcatta caaagatgca agatgacaag acagggggtg tgcccatcag aacagtcaag agctttctct ccaaaatccc cagtgtcgtc acaggtactg acattgtgca gtggcttatg aagaaccttt ccattgagga cccagttgaa gcaatacact tggggagcct tatcgctgcc cagggctaca tctttccaat ctcagaccat gttctcacca tgaaggatga tggcaccttt tatcgtttcc aggctccgta cttctggcct tcgaactgct gggaacctga aaacactgac tatgccatct atctctgtaa gaggacaatg caaaataaag caaggctgga actggcagat tatgaagcag aaaacttagc aagactccag agggcctttg cgaggaagtg ggaattcatc tttatgcaag cagaagcaca agtaaagatt gaccggaaaa aagacaagac agaaaggaaa attttggata gtcaagaacg agccttttgg gatgtccaca ggcctgtgcc aggctgtgtg aacacaacag aaatggatat ccgaaaatgt cgacgtttga agaatccaca aaaggttaaa aagtccgtgt atggcgtgac tgaagagtcc caggcacaga gcccggtgca tgtactcagc caaccaatca ggaaaacaac aaaagaggac atccggaaac agataacatt tttgaacgca cagatcgaca gacattgttt gaaaatgtcc aaagtggctg aaagtttaat tgcctacacg gaacaatatg tggaatatga ccctttgata acaccagctg agccatccaa cccttggatc agcgatgacg ttgctttgtg ggacatagag atgagcaaag agcccagcca acagcgagta aaaagatggg gcttctcttt cgatgagata ttgaaggacc aggtggggcg ggaccagttt ctacgattcc tggagtccga attcagttca gaaaacctca ggttctggct ggctgtccaa gatcttaaga aacaacccct acaggatgtg gccaagaggg tagaagaaat ctggcaagag tttctggctc caggggctcc aagtgcaatc aacctggatt ctcacagcta tgagataacc agtcaaaatg tcaaagatgg agggagatat acatttgaag acgcccagga gcacatctac aagctgatga agagtgacag ctatgcccgc ttcctccggt caaatgctta ccaggatttg ctgctggcca agaagaaggg aaagtcgctg gcgggcaagc gcctcacggg cctgatgcag tcctcctga. It is sometimes possible for the material contained within the vial of "RGS6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.