Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS4 cdna clone

RGS4 cDNA Clone

Gene Names
RGS4; RGP4; SCZD9
Synonyms
RGS4; RGS4 cDNA Clone; RGS4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgcaaagggcttgcaggtctgccggcttcttgcttgaggagtgcaaaagatatgaaacatcggctaggtttcctgctgcaaaaatctgattcctgtgaacacaattcttcccacaacaagaaggacaaagtggttatttgccagagagtgagccaagaggaagtcaagaaatgggctgaatcactggaaaacctgattagtcatgaatgtgggctggcagctttcaaagctttcttgaagtctgaatatagtgaggagaatattgacttctggatcagctgtgaagagtacaagaaaatcaaatcaccatctaaactaagtcccaaggccaaaaagatctataatgaattcatctcagtccaggcaaccaaagaggtgaacctggattcttgcaccagggaagagacaagccggaacatgctagagcctacaataacctgctttgatgaggcccagaagaagattttcaacctgatggagaaggattcctaccgccgcttcctcaagtctcgattctatcttgatttggtcaacccgtccagctgtggggcagaaaagcagaaaggagccaagagttcagcagactgtgcttccctggtccctcagtgtgcctaa
Sequence Length
618
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,452 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 4, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 4
NCBI Official Symbol
RGS4
NCBI Official Synonym Symbols
RGP4; SCZD9
NCBI Protein Information
regulator of G-protein signaling 4
UniProt Protein Name
Regulator of G-protein signaling 4
UniProt Gene Name
RGS4
UniProt Synonym Gene Names
RGP4; RGS4
UniProt Entry Name
RGS4_HUMAN

NCBI Description

Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 4 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. Regulator of G protein signaling 4 protein is 37% identical to RGS1 and 97% identical to rat Rgs4. This protein negatively regulate signaling upstream or at the level of the heterotrimeric G protein and is localized in the cytoplasm. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

RGS4: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Activity on G(z)-alpha is inhibited by phosphorylation of the G-protein. Activity on G(z)-alpha and G(i)-alpha-1 is inhibited by palmitoylation of the G-protein. Expressed in brain and heart. Expressed in brain at protein level. Expressed in prefontal and visual cortex. Isoform 4 and isoform 5 are expressed ubiquitously. Isoform 1, isoform 2 and isoform 3 are not expressed in the cerebellum. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: GAPs, RGS; GAPs

Chromosomal Location of Human Ortholog: 1q23.3

Cellular Component: cytoplasm; nucleus; plasma membrane

Molecular Function: calmodulin binding

Biological Process: inactivation of MAPK activity; regulation of G-protein coupled receptor protein signaling pathway

Disease: Schizophrenia 9

Research Articles on RGS4

Similar Products

Product Notes

The RGS4 rgs4 (Catalog #AAA1274375) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgcaaag ggcttgcagg tctgccggct tcttgcttga ggagtgcaaa agatatgaaa catcggctag gtttcctgct gcaaaaatct gattcctgtg aacacaattc ttcccacaac aagaaggaca aagtggttat ttgccagaga gtgagccaag aggaagtcaa gaaatgggct gaatcactgg aaaacctgat tagtcatgaa tgtgggctgg cagctttcaa agctttcttg aagtctgaat atagtgagga gaatattgac ttctggatca gctgtgaaga gtacaagaaa atcaaatcac catctaaact aagtcccaag gccaaaaaga tctataatga attcatctca gtccaggcaa ccaaagaggt gaacctggat tcttgcacca gggaagagac aagccggaac atgctagagc ctacaataac ctgctttgat gaggcccaga agaagatttt caacctgatg gagaaggatt cctaccgccg cttcctcaag tctcgattct atcttgattt ggtcaacccg tccagctgtg gggcagaaaa gcagaaagga gccaagagtt cagcagactg tgcttccctg gtccctcagt gtgcctaa. It is sometimes possible for the material contained within the vial of "RGS4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.