Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS18 cdna clone

RGS18 cDNA Clone

Gene Names
RGS18; RGS13
Synonyms
RGS18; RGS18 cDNA Clone; RGS18 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaacaacattgcttttcttttctcaaataaatatgtgtgaatcaaaagaaaaaacttttttcaagttaatacatggttcaggaaaagaagaaacaagcaaagaagccaaaatcagagctaaggaaaaaagaaatagactaagtcttcttgtgcagaaacctgagtttcatgaagacacccgctccagtagatctgggcacttggccaaagaaacaagagtctcccctgaagaggcagtgaaatggggtgaatcatttgacaaactgctttcccatagagatggactagaggcttttaccagatttcttaaaactgaattcagtgaagaaaatattgaattttggatagcctgtgaagatttcaagaaaagcaagggacctcaacaaattcaccttaaagcaaaagcaatatatgagaaatttatacagactgatgccccaaaagaggttaaccttgattttcacacaaaagaagtcattacaaacagcatcactcaacctaccctccacagttttgatgctgcacaaagcagagtgtatcagctcatggaacaagacagttatacacgttttctgaaatctgacatctatttagacttgatggaaggaagacctcagagaccaacaaatcttaggagacgatcacgctcatttacctgcaatgaattccaagatgtacaatcagacgttgccatttggttataa
Sequence Length
708
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,582 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 18, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 18
NCBI Official Symbol
RGS18
NCBI Official Synonym Symbols
RGS13
NCBI Protein Information
regulator of G-protein signaling 18
UniProt Protein Name
Regulator of G-protein signaling 18
UniProt Gene Name
RGS18
UniProt Synonym Gene Names
RGS13; RGS18
UniProt Entry Name
RGS18_HUMAN

NCBI Description

This gene encodes a member of the regulator of G-protein signaling family. This protein is contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signaling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

RGS18: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to G(i) alpha-1, G(i) alpha- 2, G(i) alpha-3 and G(q) alpha.

Protein type: GAPs; GAPs, RGS

Chromosomal Location of Human Ortholog: 1q31.2

Cellular Component: cytoplasm; plasma membrane

Molecular Function: GTPase activator activity

Research Articles on RGS18

Similar Products

Product Notes

The RGS18 rgs18 (Catalog #AAA1265893) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaacaa cattgctttt cttttctcaa ataaatatgt gtgaatcaaa agaaaaaact tttttcaagt taatacatgg ttcaggaaaa gaagaaacaa gcaaagaagc caaaatcaga gctaaggaaa aaagaaatag actaagtctt cttgtgcaga aacctgagtt tcatgaagac acccgctcca gtagatctgg gcacttggcc aaagaaacaa gagtctcccc tgaagaggca gtgaaatggg gtgaatcatt tgacaaactg ctttcccata gagatggact agaggctttt accagatttc ttaaaactga attcagtgaa gaaaatattg aattttggat agcctgtgaa gatttcaaga aaagcaaggg acctcaacaa attcacctta aagcaaaagc aatatatgag aaatttatac agactgatgc cccaaaagag gttaaccttg attttcacac aaaagaagtc attacaaaca gcatcactca acctaccctc cacagttttg atgctgcaca aagcagagtg tatcagctca tggaacaaga cagttataca cgttttctga aatctgacat ctatttagac ttgatggaag gaagacctca gagaccaaca aatcttagga gacgatcacg ctcatttacc tgcaatgaat tccaagatgt acaatcagac gttgccattt ggttataa. It is sometimes possible for the material contained within the vial of "RGS18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.