Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS13 cdna clone

RGS13 cDNA Clone

Synonyms
RGS13; RGS13 cDNA Clone; RGS13 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcaggcggaattgttggatttgtaagatgtgcagagatgaatctaagaggcccccttcaaaccttactttggaggaagtattacagtgggcccagtcttttgaaaatttaatggctacaaaatatggtccagtagtctatgcagcatatttaaaaatggagcacagtgacgagaatattcaattctggatggcatgtgaaacctataagaaaattgcctcacggtggagcagaatttctagggcaaagaagctttataagatttacatccagccacagtcccctagagagattaacattgacagttcgacaagagagactatcatcaggaacattcaggaacccactgaaacatgttttgaagaagctcagaaaatagtctatatgcatatggaaagggattcctaccccagatttctaaagtcagaaatgtaccaaaaacttttgaaaactatgcagtccaacaacagtttctga
Sequence Length
480
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,135 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 13, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 13
NCBI Official Symbol
RGS13
NCBI Protein Information
regulator of G-protein signaling 13
UniProt Protein Name
Regulator of G-protein signaling 13
UniProt Gene Name
RGS13
UniProt Synonym Gene Names
RGS13
UniProt Entry Name
RGS13_HUMAN

NCBI Description

The protein encoded by this gene is a member of the regulator of G protein signaling (RGS) family. RGS family members share similarity with S. cerevisiae SST2 and C. elegans egl-10 proteins, which contain a characteristic conserved RGS domain. RGS proteins accelerate GTPase activity of G protein alpha-subunits, thereby driving G protein into their inactive GDP-bound form, thus negatively regulating G protein signaling. RGS proteins have been implicated in the fine tuning of a variety of cellular events in response to G protein-coupled receptor activation. The biological function of this gene, however, is unknown. Two transcript variants encoding the same isoform exist. [provided by RefSeq, Jul 2008]

Uniprot Description

RGS13: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to both G(i)-alpha and G(q)- alpha.

Protein type: GAPs; GAPs, RGS

Chromosomal Location of Human Ortholog: 1q31.2

Cellular Component: cytoplasm; plasma membrane

Molecular Function: GTPase activator activity

Research Articles on RGS13

Similar Products

Product Notes

The RGS13 rgs13 (Catalog #AAA1267528) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaggc ggaattgttg gatttgtaag atgtgcagag atgaatctaa gaggccccct tcaaacctta ctttggagga agtattacag tgggcccagt cttttgaaaa tttaatggct acaaaatatg gtccagtagt ctatgcagca tatttaaaaa tggagcacag tgacgagaat attcaattct ggatggcatg tgaaacctat aagaaaattg cctcacggtg gagcagaatt tctagggcaa agaagcttta taagatttac atccagccac agtcccctag agagattaac attgacagtt cgacaagaga gactatcatc aggaacattc aggaacccac tgaaacatgt tttgaagaag ctcagaaaat agtctatatg catatggaaa gggattccta ccccagattt ctaaagtcag aaatgtacca aaaacttttg aaaactatgc agtccaacaa cagtttctga. It is sometimes possible for the material contained within the vial of "RGS13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.