Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RFX4 cdna clone

RFX4 cDNA Clone

Gene Names
RFX4; NYD-SP10
Synonyms
RFX4; RFX4 cDNA Clone; RFX4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaactgggctgccttcggagggtctgaattcttcatcccagaaggcattcagatagattcgagatgcccactaagcagaaatatcacggaatggtaccattactatggcattgcagtgaaagaaagctcccaatattatgatgtgatgtattccaagaaaggagctgcctgggtgagtgagacgggcaagaaagaagtgagcaaacagacagtggcatattcaccccggtccaaactcggaacactgctgccagaatttcccaatgtcaaagatctaaatctgccagccagcctgcctgaggagaaggtttctacctttattatgatgtacagaacacactgtcagagaatactggacactgtaataagagccaactttgatgaggttcaaagtttccttctgcacttttggcaaggaatgccgccccacatgctgcctgtgctgggctcctccacggtggtgaacattgtcggcgtgtgtgactccatcctctacaaagctatctccggggtgctgatgcccactgtgctgcaggcattacctgacagcttaactcaggtgattcgaaagtttgccaagcaactggatgagtggctaaaagtggctctccacgacctcccagaaaacttgcgaaacatcaagttcgaattgtcgagaaggttctcccaaattctgagacggcaaacatcactaaatcatctctgccaggcatctcgaacagtgatccacagtgcagacatcacgttccaaatgctggaagactggaggaacgtggacctgaacagcatcaccaagcaaaccctttacaccatggaagactctcgcgatgagcaccggaaactcatcacccaattatatcaggagtttgaccatctcttggaggagcagtctcccatcgagtcctacattgagtggctggataccatggttgaccgctgtgttgtgaaggtggctgccaagagacaagggtccttgaagaaagtggcccagcagttcctcttgatgtggtcctgtttcggcacaagggtgatccgggacatgaccttgcacagcgcccccagcttcgggtcttttcacctaattcacttaatgtttgatgactacgtgctctacctgttagaatctctgcactgtcaggagcgaaccaatgagctcatgcgagccatgaagggagaaggaagcactgcagaagtccgagaagagatcatcttgacagaggctgccgcaccaaccccttcaccagtgccatcgttttctccagcaaaatctgccacatctgtggaagtgccacctccctcttcccctgttagcaatccttcccctgagtacactggcctcagcactacaggagcaatgcagtcttacacgtggtctctaacatacacagtgacgacggctgctgggtccccagctgagaactcccaacagctgccctgtatgaggaacactcatgtgccttcttcctccgtcacacacaggataccagtttatccccacagagaggaacatggatacacgggaagctataactatgggagctatggcaaccagcatcctcaccccatgcagagccagtatccggccctccctcatgacacagctatctctgggccactccactatgccccttaccacaggagctctgcacagtacccttttaatagccccacttcccggatggaaccttgtttgatgagcagtactcccagactgcatcctaccccagtcactccccgctggccagaggtgccctcagccaacacgtgctacacaagcccgtctgtgcattctgcgaggtacggaaactctagtgacatgtatacacctctgacaacgcgcaggaattctgaatatgagcacatgcaacactttcctggctttgcttacatcaacggagaggcctctacaggatgggctaaatga
Sequence Length
1926
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,181 Da
NCBI Official Full Name
Homo sapiens regulatory factor X, 4 (influences HLA class II expression), mRNA
NCBI Official Synonym Full Names
regulatory factor X4
NCBI Official Symbol
RFX4
NCBI Official Synonym Symbols
NYD-SP10
NCBI Protein Information
transcription factor RFX4
UniProt Protein Name
Transcription factor RFX4
Protein Family
UniProt Gene Name
RFX4
UniProt Entry Name
RFX4_HUMAN

NCBI Description

This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]

Uniprot Description

RFX4: May activate transcription by interacting directly with the X-box. Belongs to the RFX family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 12q24

Cellular Component: nucleus

Molecular Function: protein binding

Biological Process: cilium biogenesis; negative regulation of smoothened signaling pathway in ventral spinal cord patterning; positive regulation of transcription from RNA polymerase II promoter

Research Articles on RFX4

Similar Products

Product Notes

The RFX4 rfx4 (Catalog #AAA1275094) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactggg ctgccttcgg agggtctgaa ttcttcatcc cagaaggcat tcagatagat tcgagatgcc cactaagcag aaatatcacg gaatggtacc attactatgg cattgcagtg aaagaaagct cccaatatta tgatgtgatg tattccaaga aaggagctgc ctgggtgagt gagacgggca agaaagaagt gagcaaacag acagtggcat attcaccccg gtccaaactc ggaacactgc tgccagaatt tcccaatgtc aaagatctaa atctgccagc cagcctgcct gaggagaagg tttctacctt tattatgatg tacagaacac actgtcagag aatactggac actgtaataa gagccaactt tgatgaggtt caaagtttcc ttctgcactt ttggcaagga atgccgcccc acatgctgcc tgtgctgggc tcctccacgg tggtgaacat tgtcggcgtg tgtgactcca tcctctacaa agctatctcc ggggtgctga tgcccactgt gctgcaggca ttacctgaca gcttaactca ggtgattcga aagtttgcca agcaactgga tgagtggcta aaagtggctc tccacgacct cccagaaaac ttgcgaaaca tcaagttcga attgtcgaga aggttctccc aaattctgag acggcaaaca tcactaaatc atctctgcca ggcatctcga acagtgatcc acagtgcaga catcacgttc caaatgctgg aagactggag gaacgtggac ctgaacagca tcaccaagca aaccctttac accatggaag actctcgcga tgagcaccgg aaactcatca cccaattata tcaggagttt gaccatctct tggaggagca gtctcccatc gagtcctaca ttgagtggct ggataccatg gttgaccgct gtgttgtgaa ggtggctgcc aagagacaag ggtccttgaa gaaagtggcc cagcagttcc tcttgatgtg gtcctgtttc ggcacaaggg tgatccggga catgaccttg cacagcgccc ccagcttcgg gtcttttcac ctaattcact taatgtttga tgactacgtg ctctacctgt tagaatctct gcactgtcag gagcgaacca atgagctcat gcgagccatg aagggagaag gaagcactgc agaagtccga gaagagatca tcttgacaga ggctgccgca ccaacccctt caccagtgcc atcgttttct ccagcaaaat ctgccacatc tgtggaagtg ccacctccct cttcccctgt tagcaatcct tcccctgagt acactggcct cagcactaca ggagcaatgc agtcttacac gtggtctcta acatacacag tgacgacggc tgctgggtcc ccagctgaga actcccaaca gctgccctgt atgaggaaca ctcatgtgcc ttcttcctcc gtcacacaca ggataccagt ttatccccac agagaggaac atggatacac gggaagctat aactatggga gctatggcaa ccagcatcct caccccatgc agagccagta tccggccctc cctcatgaca cagctatctc tgggccactc cactatgccc cttaccacag gagctctgca cagtaccctt ttaatagccc cacttcccgg atggaacctt gtttgatgag cagtactccc agactgcatc ctaccccagt cactccccgc tggccagagg tgccctcagc caacacgtgc tacacaagcc cgtctgtgca ttctgcgagg tacggaaact ctagtgacat gtatacacct ctgacaacgc gcaggaattc tgaatatgag cacatgcaac actttcctgg ctttgcttac atcaacggag aggcctctac aggatgggct aaatga. It is sometimes possible for the material contained within the vial of "RFX4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.