REM2 cdna clone
REM2 cDNA Clone
Synonyms
REM2; REM2 cDNA Clone; REM2 cdna clone
Sequence
atggacacagaaaccacagcactctgcccctctggcagccgccgggcctcccctccagggacgcccacaccagaagcagatgccacgctactaaagaagtcagagaaactgttggcagagttggaccggagcgggttaccctctgcccctggggcccccagacgaagaggcagtatgcctgtcccctacaagcaccagctccggcgggcccaggctgtagatgaacttgactggccacctcaggcctcatcctctggctcgtctgactccttgggctcaggggaggcagcccctgctcaaaaggatggcatcttcaaggtcatgctagtgggggagagcggcgtgggcaagagcaccctagcaggcacttttggtggtctccagggagacagtgctcacgaaccggagaacccagaggatacctatgagagacgcatcatggtggataaggaggaagtgactctagtcgtttatgacatctgggaacagggggatgcaggagggtggctgcgggaccactgccttcagaccggggacgcctttctcatcgtcttctcagtcaccgaccgacggagtttctccaaagttccagagaccctacttcggctccgggctgggaggccgcaccacgacctacccgttatcctcgttggaaacaagagcgacttggcccgctcccgggaggtatcactggaggagggccgccacctggccgggacgctgagctgcaagcacatcgagacgtcggccgcactgcaccacaacacgagggagctcttcgagggcgcggtgcgccagatccggctgcggcggggccgaaaccacgccggaggccagaggcccgatccgggcagccccgagggccctgcgccacctgcacgccgcgagagcctcaccaagaaagccaagaggttcctcgccaacctggtgccgcgcaacgccaagttcttcaagcagcgctccaggtcgtgtcacgacctctcggtgctctga
Sequence Length
993
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,295 Da
NCBI Official Full Name
Homo sapiens RAS (RAD and GEM)-like GTP binding 2, mRNA
NCBI Official Synonym Full Names
RRAD and GEM like GTPase 2
NCBI Official Symbol
REM2
NCBI Protein Information
GTP-binding protein REM 2
UniProt Protein Name
GTP-binding protein REM 2
Protein Family
UniProt Gene Name
REM2
UniProt Entry Name
REM2_HUMAN
Uniprot Description
REM2: Binds GTP saturably and exhibits a low intrinsic rate of GTP hydrolysis. Belongs to the small GTPase superfamily. RGK family.
Protein type: G protein, monomeric, RGK; G protein, monomeric; G protein
Chromosomal Location of Human Ortholog: 14q11.2
Research Articles on REM2
Similar Products
Product Notes
The REM2 rem2 (Catalog #AAA1273286) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacacag aaaccacagc actctgcccc tctggcagcc gccgggcctc ccctccaggg acgcccacac cagaagcaga tgccacgcta ctaaagaagt cagagaaact gttggcagag ttggaccgga gcgggttacc ctctgcccct ggggccccca gacgaagagg cagtatgcct gtcccctaca agcaccagct ccggcgggcc caggctgtag atgaacttga ctggccacct caggcctcat cctctggctc gtctgactcc ttgggctcag gggaggcagc ccctgctcaa aaggatggca tcttcaaggt catgctagtg ggggagagcg gcgtgggcaa gagcacccta gcaggcactt ttggtggtct ccagggagac agtgctcacg aaccggagaa cccagaggat acctatgaga gacgcatcat ggtggataag gaggaagtga ctctagtcgt ttatgacatc tgggaacagg gggatgcagg agggtggctg cgggaccact gccttcagac cggggacgcc tttctcatcg tcttctcagt caccgaccga cggagtttct ccaaagttcc agagacccta cttcggctcc gggctgggag gccgcaccac gacctacccg ttatcctcgt tggaaacaag agcgacttgg cccgctcccg ggaggtatca ctggaggagg gccgccacct ggccgggacg ctgagctgca agcacatcga gacgtcggcc gcactgcacc acaacacgag ggagctcttc gagggcgcgg tgcgccagat ccggctgcgg cggggccgaa accacgccgg aggccagagg cccgatccgg gcagccccga gggccctgcg ccacctgcac gccgcgagag cctcaccaag aaagccaaga ggttcctcgc caacctggtg ccgcgcaacg ccaagttctt caagcagcgc tccaggtcgt gtcacgacct ctcggtgctc tga. It is sometimes possible for the material contained within the vial of "REM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
