Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RCN1 cdna clone

RCN1 cDNA Clone

Gene Names
RCN1; RCN; RCAL; PIG20; HEL-S-84
Synonyms
RCN1; RCN1 cDNA Clone; RCN1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcgcggtggccgcggccgccgcctggggttagccctggggctgctgctggcgctggtgctggcgccgcgggttctgcgggccaagcccacggtgcgcaaagagcgcgtggtgcggcccgactcggagctgggcgagcggccccctgaggacaaccagagcttccagtacgaccacgaggccttcctgggcaaggaggactccaagaccttcgaccagctcaccccggacgagagcaaggagaggctagggaagattgttgatcgaatcgacaatgatggggatggctttgtcactactgaggagctgaaaacctggatcaaacgggtgcagaaaagatacatctttgataatgtcgccaaagtctggaaggattatgatagggacaaggatgataaaatttcctgggaagaatacaaacaagccacctatggttactacctaggaaaccccgcagagtttcatgattcttcagatcatcacacctttaaaaagatgctgccacgtgatgagagaagattcaaagctgcagacctcaatggtgacctgacagctactcgggaggagttcactgcctttctgcatcctgaagagtttgaacatatgaaggaaattgtggttttggaaaccctggaggacatcgacaagaacggggatgggtttgtggatcaggatgagtatattgcggatatgttttcccatgaggagaatggccctgagccagactgggttttatcagaacgggagcagtttaacgaattccgggatctgaacaaggacgggaagttagacaaagatgagattcgccactggatcctccctcaagattatgatcatgcacaggctgaggccaggcatctggtatatgaatcagacaaaaacaaggatgagaagctaactaaagaggaaatattggagaactggaacatgtttgtcggaagccaagctaccaattacggggaagatctcacaaaaaatcatgatgagctttga
Sequence Length
996
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,026 Da
NCBI Official Full Name
Homo sapiens reticulocalbin 1, EF-hand calcium binding domain, mRNA
NCBI Official Synonym Full Names
reticulocalbin 1
NCBI Official Symbol
RCN1
NCBI Official Synonym Symbols
RCN; RCAL; PIG20; HEL-S-84
NCBI Protein Information
reticulocalbin-1
UniProt Protein Name
Reticulocalbin-1
Protein Family
UniProt Gene Name
RCN1
UniProt Synonym Gene Names
RCN
UniProt Entry Name
RCN1_HUMAN

NCBI Description

Reticulocalbin 1 is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. High conservation of amino acid residues outside of these motifs, in comparison to mouse reticulocalbin, is consistent with a possible biochemical function besides that of calcium binding. In human endothelial and prostate cancer cell lines this protein localizes to the plasma membrane.[provided by RefSeq, Jan 2009]

Uniprot Description

RCN1: May regulate calcium-dependent activities in the endoplasmic reticulum lumen or post-ER compartment. Belongs to the CREC family.

Protein type: Calcium-binding

Chromosomal Location of Human Ortholog: 11p13

Cellular Component: endoplasmic reticulum

Molecular Function: protein binding

Research Articles on RCN1

Similar Products

Product Notes

The RCN1 rcn1 (Catalog #AAA1272471) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcgcg gtggccgcgg ccgccgcctg gggttagccc tggggctgct gctggcgctg gtgctggcgc cgcgggttct gcgggccaag cccacggtgc gcaaagagcg cgtggtgcgg cccgactcgg agctgggcga gcggccccct gaggacaacc agagcttcca gtacgaccac gaggccttcc tgggcaagga ggactccaag accttcgacc agctcacccc ggacgagagc aaggagaggc tagggaagat tgttgatcga atcgacaatg atggggatgg ctttgtcact actgaggagc tgaaaacctg gatcaaacgg gtgcagaaaa gatacatctt tgataatgtc gccaaagtct ggaaggatta tgatagggac aaggatgata aaatttcctg ggaagaatac aaacaagcca cctatggtta ctacctagga aaccccgcag agtttcatga ttcttcagat catcacacct ttaaaaagat gctgccacgt gatgagagaa gattcaaagc tgcagacctc aatggtgacc tgacagctac tcgggaggag ttcactgcct ttctgcatcc tgaagagttt gaacatatga aggaaattgt ggttttggaa accctggagg acatcgacaa gaacggggat gggtttgtgg atcaggatga gtatattgcg gatatgtttt cccatgagga gaatggccct gagccagact gggttttatc agaacgggag cagtttaacg aattccggga tctgaacaag gacgggaagt tagacaaaga tgagattcgc cactggatcc tccctcaaga ttatgatcat gcacaggctg aggccaggca tctggtatat gaatcagaca aaaacaagga tgagaagcta actaaagagg aaatattgga gaactggaac atgtttgtcg gaagccaagc taccaattac ggggaagatc tcacaaaaaa tcatgatgag ctttga. It is sometimes possible for the material contained within the vial of "RCN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.