Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RCBTB2 cdna clone

RCBTB2 cDNA Clone

Gene Names
RCBTB2; RLG; CHC1L
Synonyms
RCBTB2; RCBTB2 cDNA Clone; RCBTB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagaagaacttcctcttttctctggagacagtggcaagccagtacaggctactctgtcatctttgaagatgttagatgtgggaaagtggccaattttttccctttgttctgaagaagaactacagttaattcgtcaggcttgtgtctttggcagtgctggcaatgaagttttatacactacagtaaatgatgagatttttgtgcttggcacaaactgctgtggctgtttggggttaggtgacgtccagagcaccattgaacctcggagactggattctttaaatggcaaaaaaatagcctgcctcagctatgggagtggtccacatattgtccttgcaacaacagaaggagaagtctttacctggggtcataatgcttatagccagctgggcaatgggacaactaatcatggtttagtgccctgtcatatctctactaatctgtcaaacaaacaagtcattgaagttgcctgtgggtcttaccattctttggtgctaacatctgatggagaggtatttgcctggggttataataactctgggcaggtaggatctggatcaacagttaatcagccaatccctcgaagagtcactggctgcctacaaaataaagtagttgtgaccatagcatgtgggcagatgtgctgcatggcagtagtagacacgggggaggtctatgtctggggttacaacggaaacgggcagcttggactcggcaacagtggcaaccagccaaccccttgcagagtggcagctttgcaaggcatccgtgtccagagggtcgcctgtggctacgcacacacattagtattaacagatgaaggccaagtgtatgcttggggcgccaattcttatgggcagttgggcactggcaataaaagcaaccagtcctatcctactcctgtcactgtggaaaaggacaggattatcgagattgcagcctgtcactccacacacacgtctgcggccaagacgcagggtgggcacgtgtacatgtggggccagtgccggggtcagtccgtgatcctcccgcacctcacccacttctcctgcactgacgacgtgtttgcctgctttgccacgcccgccgtcacgtggcgcctcctctccgtggaacctgatgaccacctcacagtggctgagtcactgaagagggaatttgacaacccggacactgcagacctgaagtttctagttgatggaaagtacatttatgcacataaagtccttctcaagattcgatgtgagcattttcgttcgtcattggaagataacgaggatgatattgtagaaatgagtgaattttcatatcctgtttaccgggccttcctggaatacctatacacagacagcatcagcctttctcctgaggaggcagtaggactgctagacttggctacattttatagagaaaatcgtttgaaaaagctctgccaacaaactatcaagcaaggcatctgcgaggagaatgccatcgctctgctctcggctgcggtgaagtatgatgcacaggatttagaagaattctgcttcaggttttgcataaaccatctgactgtagtaacacaaacatcaggttttgcagaaatggaccatgatctcctgaagaactttatcagcaaagcaagcagagttggagcctttaaaaattga
Sequence Length
1656
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,769 Da
NCBI Official Full Name
Homo sapiens regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2, mRNA
NCBI Official Synonym Full Names
RCC1 and BTB domain containing protein 2
NCBI Official Symbol
RCBTB2
NCBI Official Synonym Symbols
RLG; CHC1L
NCBI Protein Information
RCC1 and BTB domain-containing protein 2
UniProt Protein Name
RCC1 and BTB domain-containing protein 2
UniProt Gene Name
RCBTB2
UniProt Synonym Gene Names
CHC1L; RLG; CHC1-L
UniProt Entry Name
RCBT2_HUMAN

NCBI Description

This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]

Uniprot Description

RCBTB2: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 13q14.3

Molecular Function: protein binding; Ran guanyl-nucleotide exchange factor activity

Research Articles on RCBTB2

Similar Products

Product Notes

The RCBTB2 rcbtb2 (Catalog #AAA1277316) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagaag aacttcctct tttctctgga gacagtggca agccagtaca ggctactctg tcatctttga agatgttaga tgtgggaaag tggccaattt tttccctttg ttctgaagaa gaactacagt taattcgtca ggcttgtgtc tttggcagtg ctggcaatga agttttatac actacagtaa atgatgagat ttttgtgctt ggcacaaact gctgtggctg tttggggtta ggtgacgtcc agagcaccat tgaacctcgg agactggatt ctttaaatgg caaaaaaata gcctgcctca gctatgggag tggtccacat attgtccttg caacaacaga aggagaagtc tttacctggg gtcataatgc ttatagccag ctgggcaatg ggacaactaa tcatggttta gtgccctgtc atatctctac taatctgtca aacaaacaag tcattgaagt tgcctgtggg tcttaccatt ctttggtgct aacatctgat ggagaggtat ttgcctgggg ttataataac tctgggcagg taggatctgg atcaacagtt aatcagccaa tccctcgaag agtcactggc tgcctacaaa ataaagtagt tgtgaccata gcatgtgggc agatgtgctg catggcagta gtagacacgg gggaggtcta tgtctggggt tacaacggaa acgggcagct tggactcggc aacagtggca accagccaac cccttgcaga gtggcagctt tgcaaggcat ccgtgtccag agggtcgcct gtggctacgc acacacatta gtattaacag atgaaggcca agtgtatgct tggggcgcca attcttatgg gcagttgggc actggcaata aaagcaacca gtcctatcct actcctgtca ctgtggaaaa ggacaggatt atcgagattg cagcctgtca ctccacacac acgtctgcgg ccaagacgca gggtgggcac gtgtacatgt ggggccagtg ccggggtcag tccgtgatcc tcccgcacct cacccacttc tcctgcactg acgacgtgtt tgcctgcttt gccacgcccg ccgtcacgtg gcgcctcctc tccgtggaac ctgatgacca cctcacagtg gctgagtcac tgaagaggga atttgacaac ccggacactg cagacctgaa gtttctagtt gatggaaagt acatttatgc acataaagtc cttctcaaga ttcgatgtga gcattttcgt tcgtcattgg aagataacga ggatgatatt gtagaaatga gtgaattttc atatcctgtt taccgggcct tcctggaata cctatacaca gacagcatca gcctttctcc tgaggaggca gtaggactgc tagacttggc tacattttat agagaaaatc gtttgaaaaa gctctgccaa caaactatca agcaaggcat ctgcgaggag aatgccatcg ctctgctctc ggctgcggtg aagtatgatg cacaggattt agaagaattc tgcttcaggt tttgcataaa ccatctgact gtagtaacac aaacatcagg ttttgcagaa atggaccatg atctcctgaa gaactttatc agcaaagcaa gcagagttgg agcctttaaa aattga. It is sometimes possible for the material contained within the vial of "RCBTB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.