RC3H2 cdna clone
RC3H2 cDNA Clone
Gene Names
RC3H2; MNAB; RNF164
Synonyms
RC3H2; RC3H2 cDNA Clone; RC3H2 cdna clone
Sequence
atgcctgtgcaggcagctcaatggacagaatttctgtcctgtccaatctgctataatgaatttgatgagaatgtgcacaaacccatcagtttaggttgttcacacactgtttgcaagacctgcttgaataaacttcatcgaaaagcttgtccttttgaccagactgccatcaacacagatattgatgtacttcctgtcaacttcgcacttctccagttagttggagcccaggtaccagatcatcagtcaattaagttaagtaatctaggtgagaataaacactatgaggttgcaaagaaatgcgttgaggatttggcactctacttaaaaccactaagtggaggtaaaggtgtagctagcttgaaccagagtgcactgagccgtccaatgcaaaggaaactggtgacacttgtaaattgtcaactggtggaggaagaaggtcgtgtaagagccatgcgagcagctcgttcccttggagaaagaactgtaacagaactgatattacagcaccagaaccctcagcagttgtctgccaatctatgggccgctgtcagggctcgaggatgccagtttttagggccagctatgcaagaagaggccttgaagctggtgttactggcattagaagatggttctgccctctcaaggaaagttctggtactttttgttgtgcagagactagaaccaagatttcctcaggcatcaaaaacaagtattggtcatgttgtgcaactactgtatcgagcttcttgttttaaggttaccaaaagagatgaagactcttccctaatgcagctgaaggaggaatttcggagttatgaagcattacgcagagaacatgatgcccaaattgttcatattgccatggaagcaggactccgtatttcacctgaacagtggtcctctcttttgtatggtgatttggctcataaatcacacatgcagtctatcattgataagctacagtctccagagtcatttgcaaagagtgtccaggaattgacaattgttttgcaacgaacaggtgacccagctaacttaaatagactgaggcctcatttagagcttcttgcaaacatagaccctaatccagacgctgtttcaccaacttgggagcagctggaaaatgcaatggtagctgttaaaacagtagttcatggccttgtggacttcatacaaaattatagtagaaaaggccatgagacccctcagcctcagccaaacagcaaatacaagactagcatgtgccgagatttgcgacagcaagggggttgtccacgaggaacaaattgtacatttgcccattctcaggaagagcttgaaaagtgtaacccccgtggactatatcttcattgttgtctcctttcctcagtggctagcttgggcactgtacataatgagctctacaagcagcagcattgtgatagagagaagataagtgtgtgtgcagtgaaaagagcagaaacatgcttctcttctcagtttttttccccacttgaagagcctagagaagaggattaa
Sequence Length
1521
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
96,362 Da
NCBI Official Full Name
Homo sapiens ring finger and CCCH-type zinc finger domains 2, mRNA
NCBI Official Synonym Full Names
ring finger and CCCH-type domains 2
NCBI Official Symbol
RC3H2
NCBI Official Synonym Symbols
MNAB; RNF164
NCBI Protein Information
roquin-2
UniProt Protein Name
Roquin-2
Protein Family
UniProt Gene Name
RC3H2
UniProt Synonym Gene Names
MNAB; RNF164
UniProt Entry Name
RC3H2_HUMAN
Uniprot Description
MNAB: 6 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding; Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 9q34
Cellular Component: cell surface; cytoplasm; membrane; nucleoplasm
Molecular Function: DNA binding; ubiquitin-protein ligase activity
Biological Process: protein polyubiquitination
Research Articles on RC3H2
Similar Products
Product Notes
The RC3H2 rc3h2 (Catalog #AAA1276700) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgtgc aggcagctca atggacagaa tttctgtcct gtccaatctg ctataatgaa tttgatgaga atgtgcacaa acccatcagt ttaggttgtt cacacactgt ttgcaagacc tgcttgaata aacttcatcg aaaagcttgt ccttttgacc agactgccat caacacagat attgatgtac ttcctgtcaa cttcgcactt ctccagttag ttggagccca ggtaccagat catcagtcaa ttaagttaag taatctaggt gagaataaac actatgaggt tgcaaagaaa tgcgttgagg atttggcact ctacttaaaa ccactaagtg gaggtaaagg tgtagctagc ttgaaccaga gtgcactgag ccgtccaatg caaaggaaac tggtgacact tgtaaattgt caactggtgg aggaagaagg tcgtgtaaga gccatgcgag cagctcgttc ccttggagaa agaactgtaa cagaactgat attacagcac cagaaccctc agcagttgtc tgccaatcta tgggccgctg tcagggctcg aggatgccag tttttagggc cagctatgca agaagaggcc ttgaagctgg tgttactggc attagaagat ggttctgccc tctcaaggaa agttctggta ctttttgttg tgcagagact agaaccaaga tttcctcagg catcaaaaac aagtattggt catgttgtgc aactactgta tcgagcttct tgttttaagg ttaccaaaag agatgaagac tcttccctaa tgcagctgaa ggaggaattt cggagttatg aagcattacg cagagaacat gatgcccaaa ttgttcatat tgccatggaa gcaggactcc gtatttcacc tgaacagtgg tcctctcttt tgtatggtga tttggctcat aaatcacaca tgcagtctat cattgataag ctacagtctc cagagtcatt tgcaaagagt gtccaggaat tgacaattgt tttgcaacga acaggtgacc cagctaactt aaatagactg aggcctcatt tagagcttct tgcaaacata gaccctaatc cagacgctgt ttcaccaact tgggagcagc tggaaaatgc aatggtagct gttaaaacag tagttcatgg ccttgtggac ttcatacaaa attatagtag aaaaggccat gagacccctc agcctcagcc aaacagcaaa tacaagacta gcatgtgccg agatttgcga cagcaagggg gttgtccacg aggaacaaat tgtacatttg cccattctca ggaagagctt gaaaagtgta acccccgtgg actatatctt cattgttgtc tcctttcctc agtggctagc ttgggcactg tacataatga gctctacaag cagcagcatt gtgatagaga gaagataagt gtgtgtgcag tgaaaagagc agaaacatgc ttctcttctc agtttttttc cccacttgaa gagcctagag aagaggatta a. It is sometimes possible for the material contained within the vial of "RC3H2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
