Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBP4 cdna clone

RBP4 cDNA Clone

Gene Names
RBP4; RDCCAS; MCOPCB10
Synonyms
RBP4; RBP4 cDNA Clone; RBP4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtgggtgtgggcgctctttctgttggcggcgctgggcagcggccgcgcggagcgcgactgccgagtgagcagcttccgagtcaaggagaacttcgacaaggctcgcttctctgggacctggtacgccatggccaagaaggaccccgagggcctctttctgcaggacaacatcgtcgcggagttctccgtggacgagaccggccagatgagcgccacagccaagggccgagtccgtcttttgaataactgggacgtgtgcgcagacatggtgggcaccttcacagacaccgaggaccctgccaagttcaagatgaagtactggggcgtagcctcctttctccagaaaggaaatgatgaccactggatcgtcgacacagactacgacacgtatgccgtgcagtactcctgccgcctcctgaacctcgatggcacctgtgctgacagctactccttcgtgttttcccgggaccccaacggcctgcccccagaagcgcagaagattgtaaggcagcggcaggaggagctgtgcctggccaggcagtacaggctgatcgtccacaacggttactgcgatggcagatcagaaagaaaccttttgtag
Sequence Length
606
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,010 Da
NCBI Official Full Name
Homo sapiens retinol binding protein 4, plasma, mRNA
NCBI Official Synonym Full Names
retinol binding protein 4
NCBI Official Symbol
RBP4
NCBI Official Synonym Symbols
RDCCAS; MCOPCB10
NCBI Protein Information
retinol-binding protein 4
UniProt Protein Name
Retinol-binding protein 4
Protein Family
UniProt Gene Name
RBP4
UniProt Synonym Gene Names
PRBP; RBP
UniProt Entry Name
RET4_HUMAN

NCBI Description

This protein belongs to the lipocalin family and is the specific carrier for retinol (vitamin A alcohol) in the blood. It delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP-retinol complex interacts with transthyretin which prevents its loss by filtration through the kidney glomeruli. A deficiency of vitamin A blocks secretion of the binding protein posttranslationally and results in defective delivery and supply to the epidermal cells. [provided by RefSeq, Jul 2008]

Uniprot Description

RBP4: Delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP-retinol complex interacts with transthyretin, this prevents its loss by filtration through the kidney glomeruli. Defects in RBP4 are a cause of retinol-binding protein deficiency (RBP deficiency). This condition causes night vision problems. It produces a typical 'fundus xerophthalmicus', featuring a progressed atrophy of the retinal pigment epithelium. Belongs to the calycin superfamily. Lipocalin family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 10q23.33

Cellular Component: cytosol; extracellular region; extracellular space

Molecular Function: protein binding; retinol binding

Biological Process: cardiac muscle development; embryonic organ morphogenesis; embryonic retina morphogenesis in camera-type eye; embryonic skeletal development; eye development; female genitalia morphogenesis; gluconeogenesis; glucose homeostasis; heart development; lung development; maintenance of gastrointestinal epithelium; negative regulation of cardiac muscle cell proliferation; positive regulation of immunoglobulin secretion; positive regulation of insulin secretion; response to retinoic acid; retinoid metabolic process; retinol metabolic process; urinary bladder development; uterus development; vagina development

Disease: Microphthalmia, Isolated, With Coloboma 10; Retinal Dystrophy, Iris Coloboma, And Comedogenic Acne Syndrome

Research Articles on RBP4

Similar Products

Product Notes

The RBP4 rbp4 (Catalog #AAA1266148) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtggg tgtgggcgct ctttctgttg gcggcgctgg gcagcggccg cgcggagcgc gactgccgag tgagcagctt ccgagtcaag gagaacttcg acaaggctcg cttctctggg acctggtacg ccatggccaa gaaggacccc gagggcctct ttctgcagga caacatcgtc gcggagttct ccgtggacga gaccggccag atgagcgcca cagccaaggg ccgagtccgt cttttgaata actgggacgt gtgcgcagac atggtgggca ccttcacaga caccgaggac cctgccaagt tcaagatgaa gtactggggc gtagcctcct ttctccagaa aggaaatgat gaccactgga tcgtcgacac agactacgac acgtatgccg tgcagtactc ctgccgcctc ctgaacctcg atggcacctg tgctgacagc tactccttcg tgttttcccg ggaccccaac ggcctgcccc cagaagcgca gaagattgta aggcagcggc aggaggagct gtgcctggcc aggcagtaca ggctgatcgt ccacaacggt tactgcgatg gcagatcaga aagaaacctt ttgtag. It is sometimes possible for the material contained within the vial of "RBP4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.