RBM46 cdna clone
RBM46 cDNA Clone
Gene Names
RBM46; CT68
Synonyms
RBM46; RBM46 cDNA Clone; RBM46 cdna clone
Sequence
atgaatgaagaaaatatagatggaacaaatggatgcagtaaagttcgaactggtattcagaatgaagcagcattacttgctttgatggaaaagactggttacaacatggttcaggaaaatggacaaaggaaatttggcggtcctcctccaggttgggaaggtccacctccacctagaggctgtgaagtttttgtaggaaaaatacctcgtgatatgtatgaagatgagttagttcctgtatttgaaagagctgggaagatatatgaatttcgacttatgatggaatttagtggtgaaaatcgaggttatgcttttgtgatgtacactacaaaagaagaagcccaattagccatcagaattcttaataattatgaaattcgaccagggaagtttattggtgtgtgtgtaagcctggataattgtagattatttattggagctattcccaaggaaaagaagaaagaagaaattttagatgaaatgaagaaagttacagaaggagttgtagatgtcattgtttatccaagtgcaactgataagaccaaaaatcgtggttttgcatttgtggaatatgaatctcacagagctgctgctatggcaaggaggaaactaattccaggaacattccaactatggggccacaccattcaggtagattgggctgacccagagaaagaggtggatgaggaaaccatgcagagagttaaagttctttatgtaagaaatttaatgatctcaactacagaggaaacaattaaagcagaattcaataaatttaagcctggtgcagttgaacgggtaaagaaacttagagattatgcttttgttcactttttcaaccgagaagatgcagtggctgccatgtctgttatgaatggaaaatgcattgatggagcaagtattgaggtaacactagctaaaccagtaaataaagaaaacacttggagacagcatcttaatggtcagattagtccaaattctgaaaatctgattgtgtttgctaacaaagaagagagccacccaaaaactctaggcaagctgccaactcttcctgctcgtctcaatggtcagcatagcccaagtccgcctgaagttgaaagatgcacttaccctttttatcctggaacaaagcttactccaattagtatgtattctttaaaatccaatcattttaattctgcagtaatgcatttggattattactgcaacaaaaataactgggcaccaccagaatattatttatattcaacaacaagtcaagatgggaaagtactcttggtgtataagatagttattcctgctattgcaaatggatcccagagttacttcatgccagacaaactctgtactacgttagaagatgcaaaggaactggcagcccagtttacattacttcatttggactacaatttccatcgcagctcaataaatagtctttcccctgttagtgctaccctctcttctgggactcccagcgtgcttccttatacttcaaggccttattcttatccaggctatcctttgtcaccaacaatatcacttgctaatggcagccatgttggacagcggctatgtatctccaatcaggcctccttcttctga
Sequence Length
1602
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,283 Da
NCBI Official Full Name
Homo sapiens RNA binding motif protein 46, mRNA
NCBI Official Synonym Full Names
RNA binding motif protein 46
NCBI Official Symbol
RBM46
NCBI Official Synonym Symbols
CT68
NCBI Protein Information
probable RNA-binding protein 46
UniProt Protein Name
Probable RNA-binding protein 46
Protein Family
UniProt Gene Name
RBM46
UniProt Synonym Gene Names
CT68
UniProt Entry Name
RBM46_HUMAN
Uniprot Description
MGC27016: 3 isoforms of the human protein are produced by alternative splicing
Protein type: Cancer Testis Antigen (CTA)
Chromosomal Location of Human Ortholog: 4q32.1
Similar Products
Product Notes
The RBM46 rbm46 (Catalog #AAA1269656) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgaag aaaatataga tggaacaaat ggatgcagta aagttcgaac tggtattcag aatgaagcag cattacttgc tttgatggaa aagactggtt acaacatggt tcaggaaaat ggacaaagga aatttggcgg tcctcctcca ggttgggaag gtccacctcc acctagaggc tgtgaagttt ttgtaggaaa aatacctcgt gatatgtatg aagatgagtt agttcctgta tttgaaagag ctgggaagat atatgaattt cgacttatga tggaatttag tggtgaaaat cgaggttatg cttttgtgat gtacactaca aaagaagaag cccaattagc catcagaatt cttaataatt atgaaattcg accagggaag tttattggtg tgtgtgtaag cctggataat tgtagattat ttattggagc tattcccaag gaaaagaaga aagaagaaat tttagatgaa atgaagaaag ttacagaagg agttgtagat gtcattgttt atccaagtgc aactgataag accaaaaatc gtggttttgc atttgtggaa tatgaatctc acagagctgc tgctatggca aggaggaaac taattccagg aacattccaa ctatggggcc acaccattca ggtagattgg gctgacccag agaaagaggt ggatgaggaa accatgcaga gagttaaagt tctttatgta agaaatttaa tgatctcaac tacagaggaa acaattaaag cagaattcaa taaatttaag cctggtgcag ttgaacgggt aaagaaactt agagattatg cttttgttca ctttttcaac cgagaagatg cagtggctgc catgtctgtt atgaatggaa aatgcattga tggagcaagt attgaggtaa cactagctaa accagtaaat aaagaaaaca cttggagaca gcatcttaat ggtcagatta gtccaaattc tgaaaatctg attgtgtttg ctaacaaaga agagagccac ccaaaaactc taggcaagct gccaactctt cctgctcgtc tcaatggtca gcatagccca agtccgcctg aagttgaaag atgcacttac cctttttatc ctggaacaaa gcttactcca attagtatgt attctttaaa atccaatcat tttaattctg cagtaatgca tttggattat tactgcaaca aaaataactg ggcaccacca gaatattatt tatattcaac aacaagtcaa gatgggaaag tactcttggt gtataagata gttattcctg ctattgcaaa tggatcccag agttacttca tgccagacaa actctgtact acgttagaag atgcaaagga actggcagcc cagtttacat tacttcattt ggactacaat ttccatcgca gctcaataaa tagtctttcc cctgttagtg ctaccctctc ttctgggact cccagcgtgc ttccttatac ttcaaggcct tattcttatc caggctatcc tttgtcacca acaatatcac ttgctaatgg cagccatgtt ggacagcggc tatgtatctc caatcaggcc tccttcttct ga. It is sometimes possible for the material contained within the vial of "RBM46, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
