Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBM23 cdna clone

RBM23 cDNA Clone

Gene Names
RBM23; PP239; RNPC4; CAPERbeta
Synonyms
RBM23; RBM23 cDNA Clone; RBM23 cdna clone
Ordering
For Research Use Only!
Sequence
atggcatctgatgactttgacatagtgattgaggccatgctggaagctccctataaaaaagaagaggatgagcaacaaaggaaagaagttaaaaaggattatcctagcaataccaccagcagcaccagcaacagtggcaatgagaccagtggaagcagcaccatcggggagacaagcaatcgtagtcgagatcgggatcggtatagacggagaaatagtcggagccgaagtccaggtcggcagtgtcgtcaccgtagccgtagctgggatcgtcgacatggtagtgagtcgcgaagtcgggaccatcgtcgtgaggatcgtgtgcattacaggagtcctccacttgccactggttataggtatggacacagtaagagtcctcatttcagagagaagagcccagtcagggagccagttgataatctgagtcctgaggagcgtgatgcccgcacagttttctgtatgcagttagctgcccgaattcggcctcgagatctggaggactttttctctgctgtaggcaaggttcgcgatgtacgtatcatctcagatcggaactcacgtcgttctaagggcattgcctacgtggaattctgtgaaatccagtctgtgccactggccattgggctgactgggcagcggttgctgggagtgcctatcattgtacaggcttcacaggcagagaaaaaccgactggcagccatggccaacaacctgcaaaagggcaatggtggaccaatgcgcctctatgtgggttccctgcacttcaatatcactgaagacatgctccggggcatctttgagccctttggtaaaattgataatattgtcctgatgaaggactcagatacaggccgctctaaaggttatggtttcatcacgttctctgattctgagtgtgcccggcgggccctggaacagttgaatgggtttgagcttgctggtcgacctatgagggttggccatgtgactgagcgactggatggtggcacagacatcacttttcctgatggggaccaggagctggatctgggatcagcaggtggacgttttcagctcatggcaaagctggcagaaggcgctggaatccaactgccaagcactgctgctgctgctgctgccgccgccgcccaggctgctgccttgcaactgaatggagcagttcccttgggggccctgaatccagcagctctgactgctctgagtccagccctgaaccttgcctcccagtgtttccagctctccagcctctttaccccccagaccatgtaa
Sequence Length
1272
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,930 Da
NCBI Official Full Name
Homo sapiens RNA binding motif protein 23, mRNA
NCBI Official Synonym Full Names
RNA binding motif protein 23
NCBI Official Symbol
RBM23
NCBI Official Synonym Symbols
PP239; RNPC4; CAPERbeta
NCBI Protein Information
probable RNA-binding protein 23
UniProt Protein Name
Probable RNA-binding protein 23
UniProt Gene Name
RBM23
UniProt Synonym Gene Names
RNPC4
UniProt Entry Name
RBM23_HUMAN

NCBI Description

This gene encodes a member of the U2AF-like family of RNA binding proteins. This protein interacts with some steroid nuclear receptors, localizes to the promoter of a steroid- responsive gene, and increases transcription of steroid-responsive transcriptional reporters in a hormone-dependent manner. It is also implicated in the steroid receptor-dependent regulation of alternative splicing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

RBM23: Probable RNA-binding protein. May be involved in pre- mRNA splicing process. Belongs to the splicing factor SR family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: membrane

Molecular Function: protein binding

Similar Products

Product Notes

The RBM23 rbm23 (Catalog #AAA1270775) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatctg atgactttga catagtgatt gaggccatgc tggaagctcc ctataaaaaa gaagaggatg agcaacaaag gaaagaagtt aaaaaggatt atcctagcaa taccaccagc agcaccagca acagtggcaa tgagaccagt ggaagcagca ccatcgggga gacaagcaat cgtagtcgag atcgggatcg gtatagacgg agaaatagtc ggagccgaag tccaggtcgg cagtgtcgtc accgtagccg tagctgggat cgtcgacatg gtagtgagtc gcgaagtcgg gaccatcgtc gtgaggatcg tgtgcattac aggagtcctc cacttgccac tggttatagg tatggacaca gtaagagtcc tcatttcaga gagaagagcc cagtcaggga gccagttgat aatctgagtc ctgaggagcg tgatgcccgc acagttttct gtatgcagtt agctgcccga attcggcctc gagatctgga ggactttttc tctgctgtag gcaaggttcg cgatgtacgt atcatctcag atcggaactc acgtcgttct aagggcattg cctacgtgga attctgtgaa atccagtctg tgccactggc cattgggctg actgggcagc ggttgctggg agtgcctatc attgtacagg cttcacaggc agagaaaaac cgactggcag ccatggccaa caacctgcaa aagggcaatg gtggaccaat gcgcctctat gtgggttccc tgcacttcaa tatcactgaa gacatgctcc ggggcatctt tgagcccttt ggtaaaattg ataatattgt cctgatgaag gactcagata caggccgctc taaaggttat ggtttcatca cgttctctga ttctgagtgt gcccggcggg ccctggaaca gttgaatggg tttgagcttg ctggtcgacc tatgagggtt ggccatgtga ctgagcgact ggatggtggc acagacatca cttttcctga tggggaccag gagctggatc tgggatcagc aggtggacgt tttcagctca tggcaaagct ggcagaaggc gctggaatcc aactgccaag cactgctgct gctgctgctg ccgccgccgc ccaggctgct gccttgcaac tgaatggagc agttcccttg ggggccctga atccagcagc tctgactgct ctgagtccag ccctgaacct tgcctcccag tgtttccagc tctccagcct ctttaccccc cagaccatgt aa. It is sometimes possible for the material contained within the vial of "RBM23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.