RBM11 cdna clone
RBM11 cDNA Clone
Synonyms
RBM11; RBM11 cDNA Clone; RBM11 cdna clone
Sequence
atgttccctgctcaggaggaggccgacaggaccgtgtttgttgggaatttagaggcccgagttcgggaagagattctgtacgagctgttccttcaggcggggccactaaccaaagtgactatatgcaaagacagagaaggaaagccaaagtcttttggatttgtctgctttaaacacccagaatcggtgtcttatgccatagctttgctgaatggaattcgtttatatggaagaccaattaacgtgcagtatcgatttgggagttctcgctcttctgaaccagctaaccaaagttttgagagctgtgttaagataaattcacacaactacaggaatgaagaaatgttggtgggcagatcttcctttcccatgcagtattttccaattaataatacttctttacctcaagaatattttctctttcagaagatgcagtggcatgtgtataatccagtgctgcagcttccttactatgaaatgacagctccacttcctaatagtgcatccgtgtcttcctcactgaatcatgttccagatcttgaggctggacccagctcatataaatggactcaccaacaaccaagtgactctgacctttatcagatgacagctccacttcctaatagtgcatccgtgtcttcctcactgaatcatgttccagatcttgaggctggacccagctcatataaatggactcaccaacaaccaagtgactctgacctttatcagatgaataaacgaaagagacaaaagcaaacaagtgatagtgatagtagcacagacaacaacagaggcaacgaatgtagccaaaagttccgaaagtctaagaagaagaaaagatactag
Sequence Length
846
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,465 Da
NCBI Official Full Name
Homo sapiens RNA binding motif protein 11, mRNA
NCBI Official Synonym Full Names
RNA binding motif protein 11
NCBI Official Symbol
RBM11
NCBI Protein Information
splicing regulator RBM11
UniProt Protein Name
Splicing regulator RBM11
Protein Family
UniProt Gene Name
RBM11
UniProt Entry Name
RBM11_HUMAN
Uniprot Description
RBM11: Tissue-specific splicing factor with potential implication in the regulation of alternative splicing during neuron and germ cell differentiation. Antagonizes SRSF1-mediated BCL-X splicing. May affect the choice of alternative 5' splice sites by binding to specific sequences in exons and antagonizing the SR protein SRSF1. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 21q11
Cellular Component: nuclear speck; nucleoplasm; nucleus
Molecular Function: poly(U) binding; protein binding; protein homodimerization activity
Biological Process: regulation of alternative nuclear mRNA splicing, via spliceosome
Similar Products
Product Notes
The RBM11 rbm11 (Catalog #AAA1278806) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttccctg ctcaggagga ggccgacagg accgtgtttg ttgggaattt agaggcccga gttcgggaag agattctgta cgagctgttc cttcaggcgg ggccactaac caaagtgact atatgcaaag acagagaagg aaagccaaag tcttttggat ttgtctgctt taaacaccca gaatcggtgt cttatgccat agctttgctg aatggaattc gtttatatgg aagaccaatt aacgtgcagt atcgatttgg gagttctcgc tcttctgaac cagctaacca aagttttgag agctgtgtta agataaattc acacaactac aggaatgaag aaatgttggt gggcagatct tcctttccca tgcagtattt tccaattaat aatacttctt tacctcaaga atattttctc tttcagaaga tgcagtggca tgtgtataat ccagtgctgc agcttcctta ctatgaaatg acagctccac ttcctaatag tgcatccgtg tcttcctcac tgaatcatgt tccagatctt gaggctggac ccagctcata taaatggact caccaacaac caagtgactc tgacctttat cagatgacag ctccacttcc taatagtgca tccgtgtctt cctcactgaa tcatgttcca gatcttgagg ctggacccag ctcatataaa tggactcacc aacaaccaag tgactctgac ctttatcaga tgaataaacg aaagagacaa aagcaaacaa gtgatagtga tagtagcaca gacaacaaca gaggcaacga atgtagccaa aagttccgaa agtctaagaa gaagaaaaga tactag. It is sometimes possible for the material contained within the vial of "RBM11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
