Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBL1 cdna clone

RBL1 cDNA Clone

Gene Names
RBL1; PRB1; p107; CP107
Synonyms
RBL1; RBL1 cDNA Clone; RBL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcgaggacaagccccacgctgagggggcggcggtggtcgccgcagccggggaggcgctacaggccctgtgccaggagctgaacctggacgaggggagcgcggccgaagccctggacgactttactgccatccgaggcaactacagcctagagggagaagttacacactggttggcatgttcattatatgttgcatgccgcaaaagcattattcccacggttggaaagggtatcatggaaggcaactgtgtttcacttaccagaatactacgttcagctaaattaagtttaatacaattttttagtaaaatgaagaaatggatggacatgtcaaatctaccacaagaatttcgtgaacgtatagaaaggctagagagaaattttgaggtgtctactgtaatattcaaaaaatatgagccaatttttttagatatatttcaaaatccatatgaagaaccaccaaagttaccacgaagccggaagcagaggaggattccttgcagtgttaaggatctgtttaatttctgttggacactttttgtttatactaagggtaattttcggatgattggggatgacttagtaaactcttatcatttacttctatgctgcttggatctgatttttgccaatgcgattatgtgcccaaatagacaagacttgctaaatccatcatttaaaggtttaccatctgattttcatactgctgactttacggcttctgaagagccaccctgcatcattgctgtactgtgtgaactgcatgatggacttctcgtagaagcaaaaggaataaaggagcactactttaagccatatatttcaaaactctttgacaggaagatattaaaaggagaatgcctcctggacctttcaagttttactgataatagcaaagcagtgaataaggagtatgaagagtatgttctaactgttggtgattttgatgagaggatctttttgggagcagacgcagaagaggaaattggaacacctcgaaagttcactcgtgacaccccattagggaaactgacagcacaggctaatgtggagtataaccttcaacagcactttgaaaaaaaaaggtcatttgcaccttctaccccactgaccggacggagatatttacgagaaaaagaagcagtcattactcctgttgcatcagccacccaaagtgtgagccggttacagagtattgtggctggtctgaaaaatgcaccaagtgaccaacttataaatatttttgaatcttgtgtgcgtaatcctgtggaaaacattatgaaaatactaaaaggaataggagagactttctgtcaacactatactcaatcaacagatgaacagccaggatctcacatagactttgctgtaaacagactaaagctggcagaaattttgtattataaaatactagagactgtaatggttcaggaaacacgaagacttcatggaatggacatgtcagttcttttagagcaagatatatttcatcgttccttgatggcttgttgtttggaaattgtgctctttgcctatagctcacctcgtacttttccttggattattgaagttctcaacttgcaaccattttacttttataaggttattgaggtggtgatccgctcagaagaggggctctcaagggacatggtgaaacacctaaacagcattgaagaacagattttggagagtttagcatggagtcacgattctgcactgtgggaggctctccaggtttctgcaaacaaagttcctacctgtgaagaagttatattcccaaataactttgaaacaggaaatggaggaaatgtgcagggacatcttcccctgatgccaatgtctcctctaatgcacccaagagtcaaggaagttcgaactgacagtgggagtcttcgaagagatatgcaaccattgtctccaatttctgtccatgaacgctacagttctcctaccgcagggagtgctaagagaagactctttggagaggaccccccaaaggaaatgcttatggacaagatcataacagaaggaacaaaattgaaaatcgctccttcttcaagcattactgctgaaaatgtatcaattttacctggtcaaactcttctaacaatggccacagccccagtaacaggaacaacaggacataaagttacaattccattacatggtgtcgcaaatgatgctggagagatcacactgatacctctttccatgaatacaaatcaggagtccaaagtcaagagtcctgtatcacttactgctcattcattaattggtgcttctccaaaacagaccaatctgactaaagcacaagaggtacattcaactggaataaacaggccaaagagaactgggtccttagcactattttacagaaaggtctatcatttggcaagtgtacgcttacgtgatctatgtctaaaactggatgtttcaaatgagttacgaaggaagatatggacgtgttttgaattcactttagttcactgtcctgatctaatgaaagacaggcatttggatcagctcctcctttgtgccttttatatcatggcaaaggtaacaaaagaagaaagaacttttcaagaaattatgaaaagttataggaatcagccccaagctaatagtcacgtatatagaagtgttctgctgaaaagtattccaagagaagttgtggcatataataaaaatataaatgatgactttgaaatgatagattgtgacttagaagatgctacaaaaacacctgactgttccagtggaccagtgaaagaggaaagaggtgatcttataaaattttacaatacaatatatgtaggaagagtgaagtcatttgcactgaaatacgacttggcgaatcaggaccatatgatggatgctccaccactctctccttttccacatattaaacaacagccaggctcaccacgccgcatttcccagcagcactccatttatatttccccgcacaagaatgggtcaggccttacaccaagaagcgctctgctgtacaagttcaatggcagcccttctaaggtaaggtga
Sequence Length
3045
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
114,688 Da
NCBI Official Full Name
Homo sapiens retinoblastoma-like 1 (p107), mRNA
NCBI Official Synonym Full Names
RB transcriptional corepressor like 1
NCBI Official Symbol
RBL1
NCBI Official Synonym Symbols
PRB1; p107; CP107
NCBI Protein Information
retinoblastoma-like protein 1
UniProt Protein Name
Retinoblastoma-like protein 1
Protein Family
UniProt Gene Name
RBL1
UniProt Synonym Gene Names
p107
UniProt Entry Name
RBL1_HUMAN

NCBI Description

The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

Rb-like 1: Key regulator of entry into cell division. Directly involved in heterochromatin formation by maintaining overall chromatin structure and, in particular, that of constitutive heterochromatin by stabilizing histone methylation. Recruits and targets histone methyltransferases SUV420H1 and SUV420H2, leading to epigenetic transcriptional repression. Controls histone H4 'Lys-20' trimethylation. Probably acts as a transcription repressor by recruiting chromatin-modifying enzymes to promoters. Potent inhibitor of E2F-mediated trans-activation. Forms a complex with adenovirus E1A and with SV40 large T antigen. May bind and modulate functionally certain cellular proteins with which T and E1A compete for pocket binding. May act as a tumor suppressor. Belongs to the retinoblastoma protein (RB) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Tumor suppressor; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 20q11.2

Cellular Component: nucleoplasm

Molecular Function: protein binding; transcription factor binding

Biological Process: positive regulation of transcription from RNA polymerase II promoter; regulation of lipid kinase activity

Research Articles on RBL1

Similar Products

Product Notes

The RBL1 rbl1 (Catalog #AAA1275177) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcgagg acaagcccca cgctgagggg gcggcggtgg tcgccgcagc cggggaggcg ctacaggccc tgtgccagga gctgaacctg gacgagggga gcgcggccga agccctggac gactttactg ccatccgagg caactacagc ctagagggag aagttacaca ctggttggca tgttcattat atgttgcatg ccgcaaaagc attattccca cggttggaaa gggtatcatg gaaggcaact gtgtttcact taccagaata ctacgttcag ctaaattaag tttaatacaa ttttttagta aaatgaagaa atggatggac atgtcaaatc taccacaaga atttcgtgaa cgtatagaaa ggctagagag aaattttgag gtgtctactg taatattcaa aaaatatgag ccaatttttt tagatatatt tcaaaatcca tatgaagaac caccaaagtt accacgaagc cggaagcaga ggaggattcc ttgcagtgtt aaggatctgt ttaatttctg ttggacactt tttgtttata ctaagggtaa ttttcggatg attggggatg acttagtaaa ctcttatcat ttacttctat gctgcttgga tctgattttt gccaatgcga ttatgtgccc aaatagacaa gacttgctaa atccatcatt taaaggttta ccatctgatt ttcatactgc tgactttacg gcttctgaag agccaccctg catcattgct gtactgtgtg aactgcatga tggacttctc gtagaagcaa aaggaataaa ggagcactac tttaagccat atatttcaaa actctttgac aggaagatat taaaaggaga atgcctcctg gacctttcaa gttttactga taatagcaaa gcagtgaata aggagtatga agagtatgtt ctaactgttg gtgattttga tgagaggatc tttttgggag cagacgcaga agaggaaatt ggaacacctc gaaagttcac tcgtgacacc ccattaggga aactgacagc acaggctaat gtggagtata accttcaaca gcactttgaa aaaaaaaggt catttgcacc ttctacccca ctgaccggac ggagatattt acgagaaaaa gaagcagtca ttactcctgt tgcatcagcc acccaaagtg tgagccggtt acagagtatt gtggctggtc tgaaaaatgc accaagtgac caacttataa atatttttga atcttgtgtg cgtaatcctg tggaaaacat tatgaaaata ctaaaaggaa taggagagac tttctgtcaa cactatactc aatcaacaga tgaacagcca ggatctcaca tagactttgc tgtaaacaga ctaaagctgg cagaaatttt gtattataaa atactagaga ctgtaatggt tcaggaaaca cgaagacttc atggaatgga catgtcagtt cttttagagc aagatatatt tcatcgttcc ttgatggctt gttgtttgga aattgtgctc tttgcctata gctcacctcg tacttttcct tggattattg aagttctcaa cttgcaacca ttttactttt ataaggttat tgaggtggtg atccgctcag aagaggggct ctcaagggac atggtgaaac acctaaacag cattgaagaa cagattttgg agagtttagc atggagtcac gattctgcac tgtgggaggc tctccaggtt tctgcaaaca aagttcctac ctgtgaagaa gttatattcc caaataactt tgaaacagga aatggaggaa atgtgcaggg acatcttccc ctgatgccaa tgtctcctct aatgcaccca agagtcaagg aagttcgaac tgacagtggg agtcttcgaa gagatatgca accattgtct ccaatttctg tccatgaacg ctacagttct cctaccgcag ggagtgctaa gagaagactc tttggagagg accccccaaa ggaaatgctt atggacaaga tcataacaga aggaacaaaa ttgaaaatcg ctccttcttc aagcattact gctgaaaatg tatcaatttt acctggtcaa actcttctaa caatggccac agccccagta acaggaacaa caggacataa agttacaatt ccattacatg gtgtcgcaaa tgatgctgga gagatcacac tgatacctct ttccatgaat acaaatcagg agtccaaagt caagagtcct gtatcactta ctgctcattc attaattggt gcttctccaa aacagaccaa tctgactaaa gcacaagagg tacattcaac tggaataaac aggccaaaga gaactgggtc cttagcacta ttttacagaa aggtctatca tttggcaagt gtacgcttac gtgatctatg tctaaaactg gatgtttcaa atgagttacg aaggaagata tggacgtgtt ttgaattcac tttagttcac tgtcctgatc taatgaaaga caggcatttg gatcagctcc tcctttgtgc cttttatatc atggcaaagg taacaaaaga agaaagaact tttcaagaaa ttatgaaaag ttataggaat cagccccaag ctaatagtca cgtatataga agtgttctgc tgaaaagtat tccaagagaa gttgtggcat ataataaaaa tataaatgat gactttgaaa tgatagattg tgacttagaa gatgctacaa aaacacctga ctgttccagt ggaccagtga aagaggaaag aggtgatctt ataaaatttt acaatacaat atatgtagga agagtgaagt catttgcact gaaatacgac ttggcgaatc aggaccatat gatggatgct ccaccactct ctccttttcc acatattaaa caacagccag gctcaccacg ccgcatttcc cagcagcact ccatttatat ttccccgcac aagaatgggt caggccttac accaagaagc gctctgctgt acaagttcaa tggcagccct tctaaggtaa ggtga. It is sometimes possible for the material contained within the vial of "RBL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.