Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RB1 cdna clone

RB1 cDNA Clone

Gene Names
RB1; RB; pRb; OSRC; pp110; p105-Rb; PPP1R130
Synonyms
RB1; RB1 cDNA Clone; RB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgcccaaaaccccccgaaaaacggccgccaccgccgccgctgccgccgcggaacccccggcaccgccgccgccgccccctcctgaggaggacccagagcaggacagcggcccggaggacctgcctctcgtcaggcttgagtttgaagaaacagaagaacctgattttactgcattatgtcagaaattaaagataccagatcatgtcagagagagagcttggttaacttgggagaaagtttcatctgtggatggagtattgggaggttatattcaaaagaaaaaggaactgtggggaatctgtatctttattgcagcagttgacctagatgagatgtcgttcacttttactgagctacagaaaaacatagaaatcagtgtccataaattctttaacttactaaaagaaattgataccagtaccaaagttgataatgctatgtcaagactgttgaagaagtatgatgtattgtttgcactcttcagcaaattggaaaggacatgtgaacttatatatttgacacaacccagcagttcgatatctactgaaataaattctgcattggtgctaaaagtttcttggatcacatttttattagctaaaggggaagtattacaaatggaagatgatctggtgatttcatttcagttaatgctatgtgtccttgactattttattaaactctcacctcccatgttgctcaaagaaccatataaaacagctgttatacccattaatggttcacctcgaacacccaggcgaggtcagaacaggagtgcacggatagcaaaacaactagaaaatgatacaagaattattgaagttctctgtaaagaacatgaatgtaatatagatgaggtgaaaaatgtttatttcaaaaattttataccttttatgaattctcttggacttgtaacatctaatggacttccagaggttgaaaatctttctaaacgatacgaagaaatttatcttaaaaataaagatctagatgcaagattatttttggatcatgataaaactcttcagactgattctatagacagttttgaaacacagagaacaccacgaaaaagtaaccttgatgaagaggtgaatgtaattcctccacacactccagttaggactgttatgaacactatccaacaattaatgatgattttaaattcagcaagtgatcaaccttcagaaaatctgatttcctattttaacaactgcacagtgaatccaaaagaaagtatactgaaaagagtgaaggatataggatacatctttaaagagaaatttgctaaagctgtgggacagggttgtgtcgaaattggatcacagcgatacaaacttggagttcgcttgtattaccgagtaatggaatccatgcttaaatcagaagaagaacgattatccattcaaaattttagcaaacttctgaatgacaacatttttcatatgtctttattggcgtgcgctcttgaggttgtaatggccacatatagcagaagtacatctcagaatcttgattctggaacagatttgtctttcccatggattctgaatgtgcttaatttaaaagcctttgatttttacaaagtgatcgaaagttttatcaaagcagaaggcaacttgacaagagaaatgataaaacatttagaacgatgtgaacatcgaatcatggaatcccttgcatggctctcagattcacctttatttgatcttattaaacaatcaaaggaccgagaaggaccaactgatcaccttgaatctgcttgtcctcttaatcttcctctccagaataatcacactgcagcagatatgtatctttctcctgtaagatctccaaagaaaaaaggttcaactacgcgtgtaaattctactgcaaatgcagagacacaagcaacctcagccttccagacccagaagccattgaaatctacctctctttcactgttttataaaaaagtgtatcggctagcctatctccggctaaatacactttgtgaacgccttctgtctgagcacccagaattagaacatatcatctggacccttttccagcacaccctgcagaatgagtatgaactcatgagagacaggcatttggaccaaattatgatgtgttccatgtatggcatatgcaaagtgaagaatatagaccttaaattcaaaatcattgtaacagcatacaaggatcttcctcatgctgttcaggagacattcaaacgtgttttgatcaaagaagaggagtatgattctattatagtattctataactcggtcttcatgcagagactgaaaacaaatattttgcagtatgcttccaccaggccccctaccttgtcaccaatacctcacattcctcgaagcccttacaagtttcctagttcacccttacggattcctggagggaacatctatatttcacccctgaagagtccatataaaatttcagaaggtctgccaacaccaacaaaaatgactccaagatcaagaatcttagtatcaattggtgaatcattcgggacttctgagaagttccagaaaataaatcagatggtatgtaacagcgaccgtgtgctcaaaagaagtgctgaaggaagcaaccctcctaaaccactgaaaaaactacgctttgatattgaaggatcagatgaagcagatggaagtaaacatctcccaggagagtccaaatttcagcagaaactggcagaaatgacttctactcgaacacgaatgcaaaagcagaaaatgaatgatagcatggatacctcaaacaaggaagagaaatga
Sequence Length
2787
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
106,159 Da
NCBI Official Full Name
Homo sapiens retinoblastoma 1, mRNA
NCBI Official Synonym Full Names
RB transcriptional corepressor 1
NCBI Official Symbol
RB1
NCBI Official Synonym Symbols
RB; pRb; OSRC; pp110; p105-Rb; PPP1R130
NCBI Protein Information
retinoblastoma-associated protein
UniProt Protein Name
Retinoblastoma-associated protein
UniProt Gene Name
RB1
UniProt Synonym Gene Names
Rb
UniProt Entry Name
RB_HUMAN

NCBI Description

The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

Uniprot Description

Rb: retinoblastoma tumor suppressor protein regulates cell proliferation by controlling progression through the G1-phase restriction point. Has three distinct binding domains and interacts with regulatory proteins including the E2F family of transcription factors, c-Abl tyrosine kinase and proteins with a conserved LXCXE motif. Cell cycle-dependent phosphorylation by Cdks inhibits Rb target binding, thus allowing cell cycle progression. Recruits and targets histone methyltransferase suv39h1 leading to epigenetic transcriptional repression.

Protein type: Tumor suppressor; Oncoprotein; Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 13q14.2

Cellular Component: chromatin; nucleoplasm; nucleus; PML body; Rb-E2F complex; SWI/SNF complex; transcription elongation factor complex b

Molecular Function: DNA binding; identical protein binding; kinase binding; phosphoprotein binding; protein binding; transcription factor activity; transcription factor binding; ubiquitin protein ligase binding

Biological Process: cell cycle arrest; cell cycle checkpoint; chromatin remodeling; G1/S transition of mitotic cell cycle; G1/S-specific transcription in mitotic cell cycle; maintenance of mitotic sister chromatid cohesion; mitotic cell cycle checkpoint; myoblast differentiation; negative regulation of protein kinase activity; negative regulation of transcription factor activity; negative regulation of transcription from RNA polymerase II promoter, mitotic; negative regulation of transcription, DNA-dependent; positive regulation of mitotic metaphase/anaphase transition; Ras protein signal transduction; regulation of lipid kinase activity; regulation of mitotic cell cycle; sister chromatid biorientation

Disease: Bladder Cancer; Osteogenic Sarcoma; Retinoblastoma; Small Cell Cancer Of The Lung

Research Articles on RB1

Similar Products

Product Notes

The RB1 rb1 (Catalog #AAA1270982) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgccca aaaccccccg aaaaacggcc gccaccgccg ccgctgccgc cgcggaaccc ccggcaccgc cgccgccgcc ccctcctgag gaggacccag agcaggacag cggcccggag gacctgcctc tcgtcaggct tgagtttgaa gaaacagaag aacctgattt tactgcatta tgtcagaaat taaagatacc agatcatgtc agagagagag cttggttaac ttgggagaaa gtttcatctg tggatggagt attgggaggt tatattcaaa agaaaaagga actgtgggga atctgtatct ttattgcagc agttgaccta gatgagatgt cgttcacttt tactgagcta cagaaaaaca tagaaatcag tgtccataaa ttctttaact tactaaaaga aattgatacc agtaccaaag ttgataatgc tatgtcaaga ctgttgaaga agtatgatgt attgtttgca ctcttcagca aattggaaag gacatgtgaa cttatatatt tgacacaacc cagcagttcg atatctactg aaataaattc tgcattggtg ctaaaagttt cttggatcac atttttatta gctaaagggg aagtattaca aatggaagat gatctggtga tttcatttca gttaatgcta tgtgtccttg actattttat taaactctca cctcccatgt tgctcaaaga accatataaa acagctgtta tacccattaa tggttcacct cgaacaccca ggcgaggtca gaacaggagt gcacggatag caaaacaact agaaaatgat acaagaatta ttgaagttct ctgtaaagaa catgaatgta atatagatga ggtgaaaaat gtttatttca aaaattttat accttttatg aattctcttg gacttgtaac atctaatgga cttccagagg ttgaaaatct ttctaaacga tacgaagaaa tttatcttaa aaataaagat ctagatgcaa gattattttt ggatcatgat aaaactcttc agactgattc tatagacagt tttgaaacac agagaacacc acgaaaaagt aaccttgatg aagaggtgaa tgtaattcct ccacacactc cagttaggac tgttatgaac actatccaac aattaatgat gattttaaat tcagcaagtg atcaaccttc agaaaatctg atttcctatt ttaacaactg cacagtgaat ccaaaagaaa gtatactgaa aagagtgaag gatataggat acatctttaa agagaaattt gctaaagctg tgggacaggg ttgtgtcgaa attggatcac agcgatacaa acttggagtt cgcttgtatt accgagtaat ggaatccatg cttaaatcag aagaagaacg attatccatt caaaatttta gcaaacttct gaatgacaac atttttcata tgtctttatt ggcgtgcgct cttgaggttg taatggccac atatagcaga agtacatctc agaatcttga ttctggaaca gatttgtctt tcccatggat tctgaatgtg cttaatttaa aagcctttga tttttacaaa gtgatcgaaa gttttatcaa agcagaaggc aacttgacaa gagaaatgat aaaacattta gaacgatgtg aacatcgaat catggaatcc cttgcatggc tctcagattc acctttattt gatcttatta aacaatcaaa ggaccgagaa ggaccaactg atcaccttga atctgcttgt cctcttaatc ttcctctcca gaataatcac actgcagcag atatgtatct ttctcctgta agatctccaa agaaaaaagg ttcaactacg cgtgtaaatt ctactgcaaa tgcagagaca caagcaacct cagccttcca gacccagaag ccattgaaat ctacctctct ttcactgttt tataaaaaag tgtatcggct agcctatctc cggctaaata cactttgtga acgccttctg tctgagcacc cagaattaga acatatcatc tggacccttt tccagcacac cctgcagaat gagtatgaac tcatgagaga caggcatttg gaccaaatta tgatgtgttc catgtatggc atatgcaaag tgaagaatat agaccttaaa ttcaaaatca ttgtaacagc atacaaggat cttcctcatg ctgttcagga gacattcaaa cgtgttttga tcaaagaaga ggagtatgat tctattatag tattctataa ctcggtcttc atgcagagac tgaaaacaaa tattttgcag tatgcttcca ccaggccccc taccttgtca ccaatacctc acattcctcg aagcccttac aagtttccta gttcaccctt acggattcct ggagggaaca tctatatttc acccctgaag agtccatata aaatttcaga aggtctgcca acaccaacaa aaatgactcc aagatcaaga atcttagtat caattggtga atcattcggg acttctgaga agttccagaa aataaatcag atggtatgta acagcgaccg tgtgctcaaa agaagtgctg aaggaagcaa ccctcctaaa ccactgaaaa aactacgctt tgatattgaa ggatcagatg aagcagatgg aagtaaacat ctcccaggag agtccaaatt tcagcagaaa ctggcagaaa tgacttctac tcgaacacga atgcaaaagc agaaaatgaa tgatagcatg gatacctcaa acaaggaaga gaaatga. It is sometimes possible for the material contained within the vial of "RB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.