RASSF9 cdna clone
RASSF9 cDNA Clone
Gene Names
RASSF9; PAMCI; PCIP1; P-CIP1
Synonyms
RASSF9; RASSF9 cDNA Clone; RASSF9 cdna clone
Sequence
atggctccctttggaagaaacttgctaaagactcggcataaaaacagatctccaactaaagacatggattcagaagagaaggaaattgtggtttgggtttgccaagaagagaagcttgtctgtgggctgactaaacgcaccacctctgctgatgtcatccaggctttgcttgaggaacatgaggctacgtttggagagaaacgatttcttctggggaagcccagtgattactgcatcatagagaagtggagaggctccgaaagggttcttcctccactaactagaatcctgaagctttggaaagcgtggggagatgagcagcccaatatgcaatttgttttggttaaagcagatgcttttcttccagttcctttgtggcggacagctgaagccaaattagtgcaaaacacagaaaaattgtgggagctcagcccagcaaactacatgaagactttaccaccagataaacaaaaaagaatagtcaggaaaactttccggaaactggctaaaattaagcaggacacagtttctcatgatcgagataatatggagacattagttcatctgatcatttcccaggaccatactattcatcagcaagtcaagagaatgaaagagctggatctggaaattgaaaagtgtgaagctaagttccatcttgatcgagtagaaaatgatggagaaaactatgttcaggatgcatatttaatgcccagtttcagtgaagttgagcaaaatctagacttgcagtatgaggaaaaccagactctggaggacctgagcgaaagtgatggaattgaacagctggaagaacgactgaaatattaccgaatactcattgataagctctctgctgaaatagaaaaagaggtaaaaagtgtttgcattgatataaatgaagatgcggaaggggaagctgcaagtgaactggaaagctctaatttagagagtgttaagtgtgatttggagaaaagcatgaaagctggtttgaaaattcactctcatttgagtggcatccagaaagagattaaatacagtgactcattgcttcagatgaaagcaaaagaatatgaactcctggccaaggaattcaattcacttcacattagcaacaaagatgggtgccagttaaaggaaaacagagcgaaggaatctgaggttcccagtagcaatggggagattcctccctttactcaaagagtatttagcaattacacaaatgacacagactcggacactggtatcagttctaaccacagtcaggactccgaaacaacagtaggagatgtggtgctgttgtcaacatag
Sequence Length
1308
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,021 Da
NCBI Official Full Name
Homo sapiens Ras association (RalGDS/AF-6) domain family (N-terminal) member 9, mRNA
NCBI Official Synonym Full Names
Ras association domain family member 9
NCBI Official Symbol
RASSF9
NCBI Official Synonym Symbols
PAMCI; PCIP1; P-CIP1
NCBI Protein Information
ras association domain-containing protein 9
UniProt Protein Name
Ras association domain-containing protein 9
Protein Family
UniProt Gene Name
RASSF9
UniProt Synonym Gene Names
PAMCI; PCIP1; P-CIP1
UniProt Entry Name
RASF9_HUMAN
NCBI Description
The protein encoded by this gene localizes to perinuclear endosomes. This protein associates with peptidylglycine alpha-amidating monooxygenase, and may be involved with the trafficking of this enzyme through secretory or endosomal pathways. [provided by RefSeq, Jul 2008]
Uniprot Description
RASSF9: May play a role in regulating vesicuar trafficking in cells.
Chromosomal Location of Human Ortholog: 12q21.31
Cellular Component: cytosol; endosome; trans-Golgi network transport vesicle membrane
Molecular Function: protein binding
Similar Products
Product Notes
The RASSF9 rassf9 (Catalog #AAA1277888) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctccct ttggaagaaa cttgctaaag actcggcata aaaacagatc tccaactaaa gacatggatt cagaagagaa ggaaattgtg gtttgggttt gccaagaaga gaagcttgtc tgtgggctga ctaaacgcac cacctctgct gatgtcatcc aggctttgct tgaggaacat gaggctacgt ttggagagaa acgatttctt ctggggaagc ccagtgatta ctgcatcata gagaagtgga gaggctccga aagggttctt cctccactaa ctagaatcct gaagctttgg aaagcgtggg gagatgagca gcccaatatg caatttgttt tggttaaagc agatgctttt cttccagttc ctttgtggcg gacagctgaa gccaaattag tgcaaaacac agaaaaattg tgggagctca gcccagcaaa ctacatgaag actttaccac cagataaaca aaaaagaata gtcaggaaaa ctttccggaa actggctaaa attaagcagg acacagtttc tcatgatcga gataatatgg agacattagt tcatctgatc atttcccagg accatactat tcatcagcaa gtcaagagaa tgaaagagct ggatctggaa attgaaaagt gtgaagctaa gttccatctt gatcgagtag aaaatgatgg agaaaactat gttcaggatg catatttaat gcccagtttc agtgaagttg agcaaaatct agacttgcag tatgaggaaa accagactct ggaggacctg agcgaaagtg atggaattga acagctggaa gaacgactga aatattaccg aatactcatt gataagctct ctgctgaaat agaaaaagag gtaaaaagtg tttgcattga tataaatgaa gatgcggaag gggaagctgc aagtgaactg gaaagctcta atttagagag tgttaagtgt gatttggaga aaagcatgaa agctggtttg aaaattcact ctcatttgag tggcatccag aaagagatta aatacagtga ctcattgctt cagatgaaag caaaagaata tgaactcctg gccaaggaat tcaattcact tcacattagc aacaaagatg ggtgccagtt aaaggaaaac agagcgaagg aatctgaggt tcccagtagc aatggggaga ttcctccctt tactcaaaga gtatttagca attacacaaa tgacacagac tcggacactg gtatcagttc taaccacagt caggactccg aaacaacagt aggagatgtg gtgctgttgt caacatag. It is sometimes possible for the material contained within the vial of "RASSF9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
