Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASSF2 cdna clone

RASSF2 cDNA Clone

Gene Names
RASSF2; CENP-34; RASFADIN
Synonyms
RASSF2; RASSF2 cDNA Clone; RASSF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggactacagccaccaaacgtccctagtcccatgtggacaagataaatacatttccaaaaatgaacttctcttgcatctgaagacctacaacttgtactatgaaggccagaatttacagctccggcaccgggaggaagaagacgagttcattgtggaggggctcctgaacatctcctggggcctgcgccggcccattcgcctgcagatgcaggatgacaacgaacgcattcgaccccctccatcctcctcctcctggcactctggctgtaacctgggggctcagggaaccactctgaagcccctgactgtgcccaaagttcagatctcagaggtggatgccccgccggagggtgaccagatgccaagctccacagactccaggggcctgaagcccctgcaggaggacaccccacagctgatgcgcacacgcagtgatgttggggtgcgtcgccgtggcaatgtgaggacgcctagtgaccagcggcgaatcagacgccaccgcttctccatcaacggccatttctacaaccataagacatccgtgttcacaccagcctatggctctgtcaccaacgtccgcatcaacagcaccatgaccaccccacaggtcctgaagctgctgctcaacaaatttaagattgagaattcagcagaggagtttgccttgtacgtggtccatacgagtggtgagaaacagaagctgaaggccaccgattacccgctgattgcccgaatcctccagggcccatgtgagcagatctccaaagtgttcctaatggagaaggaccaggtggaggaagtcacctacgacgtggcccagtatataaagttcgagatgccggtacttaaaagcttcattcagaagctccaggaggaagaagatcgggaagtaaagaagctgatgcgcaagtacaccgtgctccggctaatgattcgacagaggctggaggagatagccgagaccccagcaacaatctga
Sequence Length
981
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,879 Da
NCBI Official Full Name
Homo sapiens Ras association (RalGDS/AF-6) domain family member 2, mRNA
NCBI Official Synonym Full Names
Ras association domain family member 2
NCBI Official Symbol
RASSF2
NCBI Official Synonym Symbols
CENP-34; RASFADIN
NCBI Protein Information
ras association domain-containing protein 2
UniProt Protein Name
Ras association domain-containing protein 2
UniProt Gene Name
RASSF2
UniProt Entry Name
RASF2_HUMAN

NCBI Description

This gene encodes a protein that contains a Ras association domain. Similar to its cattle and sheep counterparts, this gene is located near the prion gene. Two alternatively spliced transcripts encoding the same isoform have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

RASSF2: Potential tumor suppressor. Acts as a KRAS-specific effector protein. May promote apoptosis and cell cycle arrest. Stabilizes STK3/MST2 by protecting it from proteasomal degradation.

Protein type: Tumor suppressor; Cell cycle regulation

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: cytoplasm; kinetochore; nucleus; protein complex

Molecular Function: protein binding; protein kinase activity

Biological Process: negative regulation of peptidyl-serine phosphorylation; positive regulation of apoptosis; positive regulation of JNK cascade; positive regulation of protein amino acid autophosphorylation; positive regulation of protein kinase activity; protein stabilization

Research Articles on RASSF2

Similar Products

Product Notes

The RASSF2 rassf2 (Catalog #AAA1268347) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactaca gccaccaaac gtccctagtc ccatgtggac aagataaata catttccaaa aatgaacttc tcttgcatct gaagacctac aacttgtact atgaaggcca gaatttacag ctccggcacc gggaggaaga agacgagttc attgtggagg ggctcctgaa catctcctgg ggcctgcgcc ggcccattcg cctgcagatg caggatgaca acgaacgcat tcgaccccct ccatcctcct cctcctggca ctctggctgt aacctggggg ctcagggaac cactctgaag cccctgactg tgcccaaagt tcagatctca gaggtggatg ccccgccgga gggtgaccag atgccaagct ccacagactc caggggcctg aagcccctgc aggaggacac cccacagctg atgcgcacac gcagtgatgt tggggtgcgt cgccgtggca atgtgaggac gcctagtgac cagcggcgaa tcagacgcca ccgcttctcc atcaacggcc atttctacaa ccataagaca tccgtgttca caccagccta tggctctgtc accaacgtcc gcatcaacag caccatgacc accccacagg tcctgaagct gctgctcaac aaatttaaga ttgagaattc agcagaggag tttgccttgt acgtggtcca tacgagtggt gagaaacaga agctgaaggc caccgattac ccgctgattg cccgaatcct ccagggccca tgtgagcaga tctccaaagt gttcctaatg gagaaggacc aggtggagga agtcacctac gacgtggccc agtatataaa gttcgagatg ccggtactta aaagcttcat tcagaagctc caggaggaag aagatcggga agtaaagaag ctgatgcgca agtacaccgt gctccggcta atgattcgac agaggctgga ggagatagcc gagaccccag caacaatctg a. It is sometimes possible for the material contained within the vial of "RASSF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.