Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASL11B cdna clone

RASL11B cDNA Clone

Synonyms
RASL11B; RASL11B cDNA Clone; RASL11B cdna clone
Ordering
For Research Use Only!
Sequence
atgcgcctcattcagaacatgtgcaccatcgccgagtaccccgcgccgggcaacgccgcggcctccgactgctgtgtgggcgccgccggccgccgcctggtcaagatcgccgtggtgggcgccagcggcgtgggcaagaccgcactggtggtccggttcctcaccaaacgattcatcggtgactatgaaagaaatgcaggtaatctctatactagacaagttcagatagaaggtgaaaccctggctcttcaggttcaagacactccaggtattcaggtccatgagaacagcctgagctgcagtgaacagctgaataggtgcattcgctgggcagatgctgtggtgatcgttttctccatcactgactacaagagctatgaactcatcagccagctccaccagcacgtgcagcagctacacctgggcacccggctgcctgtggtggtcgtggccaacaaagctgacctgttgcacatcaaacaggttgaccctcagcttggactgcagctagccagcatgctaggctgctcattctatgaagtgtctgtcagtgaaaattataatgatgtctacagcgccttccacgtcctctgtaaagaggtcagtcacaaacagcagcctagcagtacacccgagaagcgaagaacctccctcattcccaggcccaagtcacccaacatgcaggacctgaagaggaggtttaagcaagccctctctgccaaagtgaggactgtcacctccgtctga
Sequence Length
747
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,508 Da
NCBI Official Full Name
Homo sapiens RAS-like, family 11, member B, mRNA
NCBI Official Synonym Full Names
RAS like family 11 member B
NCBI Official Symbol
RASL11B
NCBI Protein Information
ras-like protein family member 11B
UniProt Protein Name
Ras-like protein family member 11B
Protein Family
UniProt Gene Name
RASL11B
UniProt Entry Name
RSLBB_HUMAN

NCBI Description

RASL11B is a member of the small GTPase protein family with a high degree of similarity to RAS (see HRAS, MIM 190020) proteins.[supplied by OMIM, Nov 2008]

Uniprot Description

RASL11B: Belongs to the small GTPase superfamily. Ras family. Induced by TGFB1

Protein type: G protein; G protein, monomeric; G protein, monomeric, Ras

Chromosomal Location of Human Ortholog: 4q12

Research Articles on RASL11B

Similar Products

Product Notes

The RASL11B rasl11b (Catalog #AAA1277499) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgcctca ttcagaacat gtgcaccatc gccgagtacc ccgcgccggg caacgccgcg gcctccgact gctgtgtggg cgccgccggc cgccgcctgg tcaagatcgc cgtggtgggc gccagcggcg tgggcaagac cgcactggtg gtccggttcc tcaccaaacg attcatcggt gactatgaaa gaaatgcagg taatctctat actagacaag ttcagataga aggtgaaacc ctggctcttc aggttcaaga cactccaggt attcaggtcc atgagaacag cctgagctgc agtgaacagc tgaataggtg cattcgctgg gcagatgctg tggtgatcgt tttctccatc actgactaca agagctatga actcatcagc cagctccacc agcacgtgca gcagctacac ctgggcaccc ggctgcctgt ggtggtcgtg gccaacaaag ctgacctgtt gcacatcaaa caggttgacc ctcagcttgg actgcagcta gccagcatgc taggctgctc attctatgaa gtgtctgtca gtgaaaatta taatgatgtc tacagcgcct tccacgtcct ctgtaaagag gtcagtcaca aacagcagcc tagcagtaca cccgagaagc gaagaacctc cctcattccc aggcccaagt cacccaacat gcaggacctg aagaggaggt ttaagcaagc cctctctgcc aaagtgagga ctgtcacctc cgtctga. It is sometimes possible for the material contained within the vial of "RASL11B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.