RARS cdna clone
RARS cDNA Clone
Gene Names
RARS; HLD9; ArgRS; DALRD1
Synonyms
RARS; RARS cDNA Clone; RARS cdna clone
Sequence
atggacgtactggtgtctgagtgctccgcgcggctgctgcagcaggaagaagagattaaatctctgactgctgaaattgaccggttgaaaaactgtggctgtttaggagcttctccaaatttggagcagttacaagaagaaaatttaaaattaaagtatcgactgaatattcttcgaaagagtcttcaggcagaaaggaacaaaccaactaaaaatatgattaacattattagccgcctacaagaggtctttggtcatgcaattaaggctgcatatccagatttggaaaatcctcctctgctagtgacaccaagtcagcaggccaagtttggggactatcagtgtaatagtgctatgggtatttctcagatgctcaaaaccaaggaacagaaagttaatccaagagaaattgctgaaaacattaccaaacacctcccagacaatgaatgtattgaaaaagttgaaattgctggtcctggttttattaatgtccacttaagaaaggattttgtatcagaacaattgaccagtcttctagtgaatggagttcaactacctgctctgggagagaataaaaaggttatagttgacttttcctcccctaatatagctaaagagatgcatgtaggccacctgaggtcaactatcataggagagagtataagccgcctctttgaatttgcagggtatgacgtgctcaggttaaatcatgtaggagactgggggacccagtttggcatgctcatcgctcacctgcaagacaaatttccagattatctaacagtttcacctcctattggggatcttcaggtcttttataaggaatctaagaagaggtttgatactgaggaggaatttaagaagcgagcatatcagtgtgtagttctgctccagggtaaaaacccagatattacaaaagcttggaagcttatctgtgatgtctcccgccaagagttaaataaaatctatgatgcattggacgtctctttaatagagagaggggaatccttctatcaagataggatgaatgatattgtaaaggaatttgaagatagaggatttgtgcaggtggatgatggcagaaagattgtatttgtcccagggtgttccataccattaaccatagtaaaatcagatggaggttatacctatgatacatctgacctggctgctattaaacaaagactatttgaggaaaaagcagatatgattatctatgttgtggacaatggacaatctgtgcacttccagacaatatttgctgctgctcaaatgattggttggtatgaccctaaagtaactcgagtcttccatgctggatttggtgtggtgctaggggaagacaagaaaaagtttaaaacacgttcgggtgaaacagtgcgcctcatggatcttctgggagaaggactaaaacgatccatggacaagttgaaggaaaaagaaagagacaaggtcttaactgcagaggaattgaatgctgctcagacatccgttgcatatggctgcatcaaatatgctgacctttcccataaccggttgaatgactacatcttctcctttgacaaaatgctagatgacagaggaaatacagctgcttacttgttgtatgccttcactagaatcaggtctattgcacgtctggccaatattgatgaagaaatgctccaaaaagctgctcgagaaaccaagattcttttggatcatgagaaggaatggaaactaggccggtgcattttacggttccctgagattctgcaaaagattttagatgacttatttctccacactctctgtgattatatatatgagctggcaactgctttcacagagttctatgatagctgctactgtgtggagaaagatagacagactggaaaaatattgaaggtgaacatgtggcgtatgctgctatgtgaagcagtagctgctgtcatggccaaggggtttgatatcctgggaataaaacctgtccaaaggatgtaa
Sequence Length
1983
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,140 Da
NCBI Official Full Name
Homo sapiens arginyl-tRNA synthetase, mRNA
NCBI Official Synonym Full Names
arginyl-tRNA synthetase
NCBI Official Symbol
RARS
NCBI Official Synonym Symbols
HLD9; ArgRS; DALRD1
NCBI Protein Information
arginine--tRNA ligase, cytoplasmic
UniProt Protein Name
Arginine--tRNA ligase, cytoplasmic
Protein Family
UniProt Gene Name
RARS
UniProt Synonym Gene Names
ArgRS
UniProt Entry Name
SYRC_HUMAN
NCBI Description
Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Uniprot Description
RARS: Forms part of a macromolecular complex that catalyzes the attachment of specific amino acids to cognate tRNAs during protein synthesis. Modulates the secretion of AIMP1 and may be involved in generation of the inflammatory cytokine EMAP2 from AIMP1. Belongs to the class-I aminoacyl-tRNA synthetase family. 2 isoforms of the human protein are produced by alternative initiation.
Protein type: Ligase; RNA-binding; Mitochondrial; Translation; EC 6.1.1.19
Chromosomal Location of Human Ortholog: 5q35.1
Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; membrane; nucleoplasm
Molecular Function: arginine-tRNA ligase activity; protein binding
Biological Process: tRNA aminoacylation for protein translation
Disease: Leukodystrophy, Hypomyelinating, 9
Research Articles on RARS
Similar Products
Product Notes
The RARS rars (Catalog #AAA1266884) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgtac tggtgtctga gtgctccgcg cggctgctgc agcaggaaga agagattaaa tctctgactg ctgaaattga ccggttgaaa aactgtggct gtttaggagc ttctccaaat ttggagcagt tacaagaaga aaatttaaaa ttaaagtatc gactgaatat tcttcgaaag agtcttcagg cagaaaggaa caaaccaact aaaaatatga ttaacattat tagccgccta caagaggtct ttggtcatgc aattaaggct gcatatccag atttggaaaa tcctcctctg ctagtgacac caagtcagca ggccaagttt ggggactatc agtgtaatag tgctatgggt atttctcaga tgctcaaaac caaggaacag aaagttaatc caagagaaat tgctgaaaac attaccaaac acctcccaga caatgaatgt attgaaaaag ttgaaattgc tggtcctggt tttattaatg tccacttaag aaaggatttt gtatcagaac aattgaccag tcttctagtg aatggagttc aactacctgc tctgggagag aataaaaagg ttatagttga cttttcctcc cctaatatag ctaaagagat gcatgtaggc cacctgaggt caactatcat aggagagagt ataagccgcc tctttgaatt tgcagggtat gacgtgctca ggttaaatca tgtaggagac tgggggaccc agtttggcat gctcatcgct cacctgcaag acaaatttcc agattatcta acagtttcac ctcctattgg ggatcttcag gtcttttata aggaatctaa gaagaggttt gatactgagg aggaatttaa gaagcgagca tatcagtgtg tagttctgct ccagggtaaa aacccagata ttacaaaagc ttggaagctt atctgtgatg tctcccgcca agagttaaat aaaatctatg atgcattgga cgtctcttta atagagagag gggaatcctt ctatcaagat aggatgaatg atattgtaaa ggaatttgaa gatagaggat ttgtgcaggt ggatgatggc agaaagattg tatttgtccc agggtgttcc ataccattaa ccatagtaaa atcagatgga ggttatacct atgatacatc tgacctggct gctattaaac aaagactatt tgaggaaaaa gcagatatga ttatctatgt tgtggacaat ggacaatctg tgcacttcca gacaatattt gctgctgctc aaatgattgg ttggtatgac cctaaagtaa ctcgagtctt ccatgctgga tttggtgtgg tgctagggga agacaagaaa aagtttaaaa cacgttcggg tgaaacagtg cgcctcatgg atcttctggg agaaggacta aaacgatcca tggacaagtt gaaggaaaaa gaaagagaca aggtcttaac tgcagaggaa ttgaatgctg ctcagacatc cgttgcatat ggctgcatca aatatgctga cctttcccat aaccggttga atgactacat cttctccttt gacaaaatgc tagatgacag aggaaataca gctgcttact tgttgtatgc cttcactaga atcaggtcta ttgcacgtct ggccaatatt gatgaagaaa tgctccaaaa agctgctcga gaaaccaaga ttcttttgga tcatgagaag gaatggaaac taggccggtg cattttacgg ttccctgaga ttctgcaaaa gattttagat gacttatttc tccacactct ctgtgattat atatatgagc tggcaactgc tttcacagag ttctatgata gctgctactg tgtggagaaa gatagacaga ctggaaaaat attgaaggtg aacatgtggc gtatgctgct atgtgaagca gtagctgctg tcatggccaa ggggtttgat atcctgggaa taaaacctgt ccaaaggatg taa. It is sometimes possible for the material contained within the vial of "RARS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
