RADIL cdna clone
RADIL cDNA Clone
Gene Names
RADIL; RASIP2
Synonyms
RADIL; RADIL cDNA Clone; RADIL cdna clone
Sequence
atgttttatgggacgcacttcatcatgtccccgcccaccaagagcaaactgaagcggcagagccagctgttgtccagcatgctgtcccggacgctgagctacaagtaccgggacctggactccaccttctccagcctgggcgccagcgatgaccccgccgagctctccacccagctgtcggcccctggtgtcctgaaggtgtttggggacagtgtctgcacaggaacccactacaagagcgtcctggccaccggcacctccagcgcccgtgagctggtgaaggaggcgctggagcggtacgccctggaccccaggcaggccggccagtacgtgctgtgtgacgtggtgggccaagccggcgatgctgggcagcggtggcaggcccggtgctttcgggtgtttggggacagtgagaagcccctcttgatccaggaattatggaaaccccgagaaggtttatcccggaggtttgagctgaggaagaggtcggacgtggaggagctggcagccaaggaggtggacaccatcacggcagggataaacgcccaggcccggaggctgcagcggagtcgcgcgaagggaaccccgaccccggccctgggggatgcccggagctctcctccaccccggttgcgccgcacagtcagtgagaccagcctgagcccagtgaacgccctgcccgctgccgcccagggccccgaggagcccggccccgacgccatgcggtactcgctgtaccagtccccgcatctgctccttctgcagggctacagccagcagcacgacagcctggtgtatgtgctcaaccgggaccggcacacggtgggccagcggaccccctccagcaagcccagcatcagcctctcagcccccgacatcctgcctctacactgcaccatccgccggcaaccgctcccggacagcggccaggccgcggggaggctggtcctggagcccatccccggggcgcacatctccgtcaacttctccgaggtggggcacaggaccgtggtgctgcaccacggggacctgctctccctggggctctactacctgctgctattcaaggaccccgcgcaggcccagcccctgcccgcccgggccttggcgcgcctccgggctgtgccgcagagctgccggctgtgcggggccgcgctcggggcccggggagccgcctcccctactcaggccgccctgccccggcgccagcagctgctcctggagtttgagccccacctggaggacacgctgctgcagaggatcatgacgttgatcgagccggggggcgacgaccacaagctgacccccgccttcctcctgtgcctctgcatccagcactcggccacccacttccagccgggcacattcgggcagctcctgctcaagatagccaggctgatccgcgagactgtctgggagaaaaccaaagaactagcagagaagcaggcgcaactccaggagcccatctcgctggccagctgcgccatggctgatctggttccagacttgcagcccattcttttctggatgtctaactccatcgagctcctgtactttatccagcagaaatgcccactctacatgcagagcatggaggagcagctggacatcacaggctcgaaggaatcgctgttctcctgcacgctgacggccagcgaggaggccatggcggtgctggaggaggtggtgctgtacgccttccagcagtgcgtctactatgtctccaagtccctgtacatctgcctcccggcactcctggagtgcccgccattccagacggagcgccgtgagagctggtcctcggcccccgaactgcccgaggagctgcgccgcgtggtgtctgtgtaccaggcagccctggacctcctgcggcagctgcaggtgcaccccgaggtggcctcgcagatgctcgcctacctcttcttcttctccgggacactgcttctcaaccagctcctcgacaggggcccctccctgagctgcttccactggcccagaggtgtccaggcctgcgcccgcctgcagcagctcctggagtggatgcggagcgccggcttcggggcggctggagagcacttcttccagaagctctcctgcaccctcaacctgctggccacacccagggcccagctcatccagatgagctggacagccctgcgggctgcgttccccgcactgagcccagcacagctgcaccggctgctgactcactaccagctggcctcggccatgggccccatgagcacctgggagccaggggcccaggacagccccgaggccttcaggtcagaggatgttctggagtcctacgaaaaccccccacccatcgtcctgcccagcgacggcttccaggtggacttggaagccaactgcctggacgacagcatctaccagcacctgctctacgtccgccactttctgtggggtctgcggagcagagccagccccggcagccctggcaggcctggcagtggggcctcccagccagtgtgccccgagggtatgcaccacgtggtccttgacgggcacctggaggccccgagctgccccctggctcccagggaccctggcccagcagcccgggaagtggccccggagcgtactcttcccttgaggggggctccctgggcacaggccccccctggaaggcaacccggccgtgggggctcccaggctggccccccgcacacggactcgtcctgcttgctcacgcctcccagcactccacttggccctgagcctggggaccccgactggccagagtccggcggcccctgtggaaaagcgctcccagagaggcagaggaacggactcagcggcctccggggtgcagctccggaaggagactctgcagcccttgcggaggagtcccctccagccccgtccagccgcagctccagcaccgaggacttctgctacgtcttcacggtggagctggaacgaggcccctccgggctggggatgggcctgatcgacgggatgcacacgcacctgggcgcccccgggctctacatccagaccctgctcccgggcagccccgcagcggccgacgggcgcctgtcgctgggggaccgtatcctggaggtgaatggcagcagcctcctgggccttggctacctgagagctgtggacctgatccgtcatggcgggaagaagatgcggttcctggtcgcgaagtccgacgtggaaacagccaagaagatccatttccgcacgccccctctctag
Sequence Length
3228
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
116,757 Da
NCBI Official Full Name
Homo sapiens Ras association and DIL domains, mRNA
NCBI Official Synonym Full Names
Rap associating with DIL domain
NCBI Official Symbol
RADIL
NCBI Official Synonym Symbols
RASIP2
NCBI Protein Information
ras-associating and dilute domain-containing protein
UniProt Protein Name
Ras-associating and dilute domain-containing protein
Protein Family
UniProt Gene Name
RADIL
UniProt Synonym Gene Names
KIAA1849
UniProt Entry Name
RADIL_HUMAN
Uniprot Description
RADIL: Downstream effector of Rap required for cell adhesion and migration of neural crest precursors during development. Belongs to the RADIL family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 7p22.1
Cellular Component: microtubule
Molecular Function: protein binding
Research Articles on RADIL
Similar Products
Product Notes
The RADIL radil (Catalog #AAA1271694) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttttatg ggacgcactt catcatgtcc ccgcccacca agagcaaact gaagcggcag agccagctgt tgtccagcat gctgtcccgg acgctgagct acaagtaccg ggacctggac tccaccttct ccagcctggg cgccagcgat gaccccgccg agctctccac ccagctgtcg gcccctggtg tcctgaaggt gtttggggac agtgtctgca caggaaccca ctacaagagc gtcctggcca ccggcacctc cagcgcccgt gagctggtga aggaggcgct ggagcggtac gccctggacc ccaggcaggc cggccagtac gtgctgtgtg acgtggtggg ccaagccggc gatgctgggc agcggtggca ggcccggtgc tttcgggtgt ttggggacag tgagaagccc ctcttgatcc aggaattatg gaaaccccga gaaggtttat cccggaggtt tgagctgagg aagaggtcgg acgtggagga gctggcagcc aaggaggtgg acaccatcac ggcagggata aacgcccagg cccggaggct gcagcggagt cgcgcgaagg gaaccccgac cccggccctg ggggatgccc ggagctctcc tccaccccgg ttgcgccgca cagtcagtga gaccagcctg agcccagtga acgccctgcc cgctgccgcc cagggccccg aggagcccgg ccccgacgcc atgcggtact cgctgtacca gtccccgcat ctgctccttc tgcagggcta cagccagcag cacgacagcc tggtgtatgt gctcaaccgg gaccggcaca cggtgggcca gcggaccccc tccagcaagc ccagcatcag cctctcagcc cccgacatcc tgcctctaca ctgcaccatc cgccggcaac cgctcccgga cagcggccag gccgcgggga ggctggtcct ggagcccatc cccggggcgc acatctccgt caacttctcc gaggtggggc acaggaccgt ggtgctgcac cacggggacc tgctctccct ggggctctac tacctgctgc tattcaagga ccccgcgcag gcccagcccc tgcccgcccg ggccttggcg cgcctccggg ctgtgccgca gagctgccgg ctgtgcgggg ccgcgctcgg ggcccgggga gccgcctccc ctactcaggc cgccctgccc cggcgccagc agctgctcct ggagtttgag ccccacctgg aggacacgct gctgcagagg atcatgacgt tgatcgagcc ggggggcgac gaccacaagc tgacccccgc cttcctcctg tgcctctgca tccagcactc ggccacccac ttccagccgg gcacattcgg gcagctcctg ctcaagatag ccaggctgat ccgcgagact gtctgggaga aaaccaaaga actagcagag aagcaggcgc aactccagga gcccatctcg ctggccagct gcgccatggc tgatctggtt ccagacttgc agcccattct tttctggatg tctaactcca tcgagctcct gtactttatc cagcagaaat gcccactcta catgcagagc atggaggagc agctggacat cacaggctcg aaggaatcgc tgttctcctg cacgctgacg gccagcgagg aggccatggc ggtgctggag gaggtggtgc tgtacgcctt ccagcagtgc gtctactatg tctccaagtc cctgtacatc tgcctcccgg cactcctgga gtgcccgcca ttccagacgg agcgccgtga gagctggtcc tcggcccccg aactgcccga ggagctgcgc cgcgtggtgt ctgtgtacca ggcagccctg gacctcctgc ggcagctgca ggtgcacccc gaggtggcct cgcagatgct cgcctacctc ttcttcttct ccgggacact gcttctcaac cagctcctcg acaggggccc ctccctgagc tgcttccact ggcccagagg tgtccaggcc tgcgcccgcc tgcagcagct cctggagtgg atgcggagcg ccggcttcgg ggcggctgga gagcacttct tccagaagct ctcctgcacc ctcaacctgc tggccacacc cagggcccag ctcatccaga tgagctggac agccctgcgg gctgcgttcc ccgcactgag cccagcacag ctgcaccggc tgctgactca ctaccagctg gcctcggcca tgggccccat gagcacctgg gagccagggg cccaggacag ccccgaggcc ttcaggtcag aggatgttct ggagtcctac gaaaaccccc cacccatcgt cctgcccagc gacggcttcc aggtggactt ggaagccaac tgcctggacg acagcatcta ccagcacctg ctctacgtcc gccactttct gtggggtctg cggagcagag ccagccccgg cagccctggc aggcctggca gtggggcctc ccagccagtg tgccccgagg gtatgcacca cgtggtcctt gacgggcacc tggaggcccc gagctgcccc ctggctccca gggaccctgg cccagcagcc cgggaagtgg ccccggagcg tactcttccc ttgagggggg ctccctgggc acaggccccc cctggaaggc aacccggccg tgggggctcc caggctggcc ccccgcacac ggactcgtcc tgcttgctca cgcctcccag cactccactt ggccctgagc ctggggaccc cgactggcca gagtccggcg gcccctgtgg aaaagcgctc ccagagaggc agaggaacgg actcagcggc ctccggggtg cagctccgga aggagactct gcagcccttg cggaggagtc ccctccagcc ccgtccagcc gcagctccag caccgaggac ttctgctacg tcttcacggt ggagctggaa cgaggcccct ccgggctggg gatgggcctg atcgacggga tgcacacgca cctgggcgcc cccgggctct acatccagac cctgctcccg ggcagccccg cagcggccga cgggcgcctg tcgctggggg accgtatcct ggaggtgaat ggcagcagcc tcctgggcct tggctacctg agagctgtgg acctgatccg tcatggcggg aagaagatgc ggttcctggt cgcgaagtcc gacgtggaaa cagccaagaa gatccatttc cgcacgcccc ctctctag. It is sometimes possible for the material contained within the vial of "RADIL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
