RAD9B cdna clone
RAD9B cDNA Clone
Synonyms
RAD9B; RAD9B cDNA Clone; RAD9B cdna clone
Sequence
atgattcaaccaagattgcttgctgatgccattgttctttttacatcaagtcaagaggaagttactcttgctgttactccactgaatttttgcctcaagagttctaatgaggaatcaatggatttgagcaatgctgtacacagtgagatgtttgttggctcagatgagtttgacttctttcaaattggaatggacactgagataacattttgtttcaaagaattgaagggaatactgacattttcagaagctacacatgctcctatatccatttattttgatttccctgggaaacctctggctttgagtattgatgatatgttagtggaagctaactttattttggccacattagctgatgaacaaagtagagcatcttcaccacagtcactgtgtctttcacagaaacgaaaaaggtcagatctgattgaaaaaaaggctggcaaaaatgtaactggccaggccctggaatgtatttcaaaaaaagcagcaccaagaaggctttatcctaaggagactctcacaaacatatctgcattggaaaactgtggcagccctgcaatgaaaagagtggatggagatgtcagtgaagtatcagaaagcagtgtcagcaacacagaggaagtgccagggtctctgtgtctcagaaagttttcttgcatgttctttggagcagtttcttctgaccagcaagaacacttcaaccaccctttcgacagtctggcaagagcaagtgacagtgaagaggacatgaataatgtgtgctgcaggaaagaatttaatggaagtgatgccaaatatttctgtattatctga
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,958 Da
NCBI Official Full Name
Homo sapiens RAD9 homolog B (S. pombe), mRNA
NCBI Official Synonym Full Names
RAD9 checkpoint clamp component B
NCBI Official Symbol
RAD9B
NCBI Protein Information
cell cycle checkpoint control protein RAD9B
UniProt Protein Name
Cell cycle checkpoint control protein RAD9B
Protein Family
UniProt Gene Name
RAD9B
UniProt Synonym Gene Names
hRAD9B
UniProt Entry Name
RAD9B_HUMAN
Uniprot Description
RAD9B: Belongs to the rad9 family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA replication
Chromosomal Location of Human Ortholog: 12q24.11
Cellular Component: nucleoplasm
Molecular Function: 3'-5' exonuclease activity; protein binding
Biological Process: DNA repair; DNA replication; DNA replication checkpoint; intra-S DNA damage checkpoint
Research Articles on RAD9B
Similar Products
Product Notes
The RAD9B rad9b (Catalog #AAA1270078) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattcaac caagattgct tgctgatgcc attgttcttt ttacatcaag tcaagaggaa gttactcttg ctgttactcc actgaatttt tgcctcaaga gttctaatga ggaatcaatg gatttgagca atgctgtaca cagtgagatg tttgttggct cagatgagtt tgacttcttt caaattggaa tggacactga gataacattt tgtttcaaag aattgaaggg aatactgaca ttttcagaag ctacacatgc tcctatatcc atttattttg atttccctgg gaaacctctg gctttgagta ttgatgatat gttagtggaa gctaacttta ttttggccac attagctgat gaacaaagta gagcatcttc accacagtca ctgtgtcttt cacagaaacg aaaaaggtca gatctgattg aaaaaaaggc tggcaaaaat gtaactggcc aggccctgga atgtatttca aaaaaagcag caccaagaag gctttatcct aaggagactc tcacaaacat atctgcattg gaaaactgtg gcagccctgc aatgaaaaga gtggatggag atgtcagtga agtatcagaa agcagtgtca gcaacacaga ggaagtgcca gggtctctgt gtctcagaaa gttttcttgc atgttctttg gagcagtttc ttctgaccag caagaacact tcaaccaccc tttcgacagt ctggcaagag caagtgacag tgaagaggac atgaataatg tgtgctgcag gaaagaattt aatggaagtg atgccaaata tttctgtatt atctga. It is sometimes possible for the material contained within the vial of "RAD9B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
