Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAD9A cdna clone

RAD9A cDNA Clone

Gene Names
RAD9A; RAD9
Synonyms
RAD9A; RAD9A cDNA Clone; RAD9A cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtgcctggtcacgggcggcaacgtgaaggtgctcggcaaggccgtccactccctgtcccgcatcggggacgagctctacctggaacccttggaggacgggctctccctccggacggtgaactcctcccgctctgcctatgcctgctttctctttgccccgctcttcttccagcaataccaggcagccacccctggtcaggacctgctgcgctgtaagatcctgatgaagtctttcctgtctgtcttccgctcactggcgatgctggagaagacggtggaaaaatgctgcatctccctgaatggccggagcagccgcctggtggtccagctgcattgcaagttcggggtgcggaagactcacaacctgtccttccaggactgtgcgtccctgcaggccgtcttcgacccagcctcgtgcccccacatgctccgcgccccagcacgggttctgggggaggctgttctgcccttctctcctgcactggctgaagtgacgctgggcattggccgtggccgcagggtcatcctgcgcagctaccacgaggaggaggcagacagcactgccaaagccatggtgactgagatgtgccttggagaggaggatttccagcagctgcaggcccaggaaggggtggccatcactttctgcctcaaggaattccgggggctcctgagctttgcagagtcagcaaacttgaatcttagcattcattttgatgctccaggcaggcccgccatcttcaccatcaaggactctttgctggacggccactttgtcttggccacactctcagacaccgactcgcactcccaggacctgggctccccagagcgtcaccagccagtgcctcagctccaggctcacagcacaccccacccggacgactttgccaatgacgacattgactcttacatgatcgccatggaaaccactataggcaatgagggctcgcgggtgctgccctccatttccctttcacctggcccccagccccccaagagccccggtccccactccgaggaggaagatgaggctgagcccagtacagtgcctgggactcccccacccaagaagttccgctcactgttcttcggctccatcctggcccctgtacgctccccccagggccccagccctgtgctggcggaagacagtgagggtgaaggctga
Sequence Length
1176
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,547 Da
NCBI Official Full Name
Homo sapiens RAD9 homolog A (S. pombe), mRNA
NCBI Official Synonym Full Names
RAD9 checkpoint clamp component A
NCBI Official Symbol
RAD9A
NCBI Official Synonym Symbols
RAD9
NCBI Protein Information
cell cycle checkpoint control protein RAD9A
UniProt Protein Name
Cell cycle checkpoint control protein RAD9A
UniProt Gene Name
RAD9A
UniProt Synonym Gene Names
hRAD9
UniProt Entry Name
RAD9A_HUMAN

NCBI Description

This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

RAD9A: a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair in response to DNA damage. Possesses a 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. Forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Use of alternative polyA sites has been noted for Rad9.

Protein type: Deoxyribonuclease; DNA replication; EC 3.1.11.2; Apoptosis; Cell cycle regulation

Chromosomal Location of Human Ortholog: 11q13.1-q13.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: 3'-5' exonuclease activity; enzyme binding; histone deacetylase binding; protein binding; protein kinase binding; SH3 domain binding

Biological Process: DNA damage checkpoint; DNA replication; DNA replication checkpoint; intra-S DNA damage checkpoint; response to DNA damage stimulus

Research Articles on RAD9A

Similar Products

Product Notes

The RAD9A rad9a (Catalog #AAA1277126) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtgcc tggtcacggg cggcaacgtg aaggtgctcg gcaaggccgt ccactccctg tcccgcatcg gggacgagct ctacctggaa cccttggagg acgggctctc cctccggacg gtgaactcct cccgctctgc ctatgcctgc tttctctttg ccccgctctt cttccagcaa taccaggcag ccacccctgg tcaggacctg ctgcgctgta agatcctgat gaagtctttc ctgtctgtct tccgctcact ggcgatgctg gagaagacgg tggaaaaatg ctgcatctcc ctgaatggcc ggagcagccg cctggtggtc cagctgcatt gcaagttcgg ggtgcggaag actcacaacc tgtccttcca ggactgtgcg tccctgcagg ccgtcttcga cccagcctcg tgcccccaca tgctccgcgc cccagcacgg gttctggggg aggctgttct gcccttctct cctgcactgg ctgaagtgac gctgggcatt ggccgtggcc gcagggtcat cctgcgcagc taccacgagg aggaggcaga cagcactgcc aaagccatgg tgactgagat gtgccttgga gaggaggatt tccagcagct gcaggcccag gaaggggtgg ccatcacttt ctgcctcaag gaattccggg ggctcctgag ctttgcagag tcagcaaact tgaatcttag cattcatttt gatgctccag gcaggcccgc catcttcacc atcaaggact ctttgctgga cggccacttt gtcttggcca cactctcaga caccgactcg cactcccagg acctgggctc cccagagcgt caccagccag tgcctcagct ccaggctcac agcacacccc acccggacga ctttgccaat gacgacattg actcttacat gatcgccatg gaaaccacta taggcaatga gggctcgcgg gtgctgccct ccatttccct ttcacctggc ccccagcccc ccaagagccc cggtccccac tccgaggagg aagatgaggc tgagcccagt acagtgcctg ggactccccc acccaagaag ttccgctcac tgttcttcgg ctccatcctg gcccctgtac gctcccccca gggccccagc cctgtgctgg cggaagacag tgagggtgaa ggctga. It is sometimes possible for the material contained within the vial of "RAD9A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.