Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAD17 cdna clone

RAD17 cDNA Clone

Gene Names
RAD17; CCYC; R24L; RAD24; HRAD17; RAD17SP
Synonyms
RAD17; RAD17 cDNA Clone; RAD17 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatcaggtaacagactgggttgacccatcatttgatgattttctagagtgtagtggcgtctctactattactgccacatcattaggtgtgaataactcaagtcatagaagaaaaaatgggccttctacattagaaagcagcagatttccagcgagaaaaagaggaaatctatcttccttagaacagatttatggtttagaaaattcaaaagaatatctgtctgaaaatgaaccatgggtggataaatataaaccagaaactcagcatgaacttgctgtgcataaaaagaaaattgaagaagtcgaaacctggttaaaagctcaagttttagaaaggcaaccaaaacagggtggatctattttattaataacaggtcctcctggatgtggaaagacaacgaccttaaaaatactatcaaaggagcatggtattcaagtacaagagtggattaatccagttttaccagacttccaaaaagatgatttcaaggggatgtttaatactgaatcaagcttccatatgtttccctatcagtctcagatagcagttttcaaagagtttctactaagagcgacaaagtataacaagttacaaatgcttggagatgatctgagaactgataagaagataattctggttgaagatttacctaaccagttttatcgggattctcatactttacatgaagttctaaggaagtatgtgaggattggtcgatgtcctcttatatttataatctcggacagtctcagtggagataataatcaaaggttattgtttcccaaagaaattcaggaagagtgttctatctcaaatattagtttcaaccctgtggcaccaacaattatgatgaaatttcttaatcgaatagtgactatagaagctaacaagaatggaggaaaaattactgtccctgacaaaacttctctagagttgctctgtcagggatgttctggtgatatcagaagtgcaataaacagcctccagttttcttcttcaaaaggagaaaacaacttacggccaaggaaaaaaggaatgtctttaaaatcagatgctgtgctgtcaaaatcaaaacgaagaaaaaaacctgatagggtttttgaaaatcaagaggtccaagctattggtggcaaagatgtttctctgtttctcttcagagctttggggaaaattctatattgtaaaagagcatctttaacagaattagactcacctcggttgccctctcatttatcagaatatgaacgggatacattacttgttgaacctgaggaggtagtagaaatgtcacacatgcctggagacttatttaatttatatcttcaccaaaactacatagatttcttcatggaaattgatgatattgtgagagccagtgaatttctgagttttgcagatatcctcagtggtgactggaatacacgctctttactcagggaatatagcacatctatagctacgagaggtgtgatgcattccaacaaagcccgaggatatgctcattgccaaggaggaggatcaagttttcgacccttgcacaaacctcagtggtttctaataaataaaaagtatcgggaaaattgcctggcagcaaaagcactttttcctgacttctgcctaccagctttatgccgccaaactcagctattgccataccttgctctactaaccattccaatgagaaatcaagctcagatttcttttatccaagatattggaaggctccctctgaagcgacactttggaagattgaaaatggaagccctgactgacagggaacatggaatgatagaccctgacagcggagatgaagcccagcttaatggaggacattctgcagaggaatctctgggtgaacccactcaagccactgtgccggaaacctggtctcttcctttgagtcagaatagtgccagtgaactgcctgctagccagccccagcccttttcagcccaaggagacatggaagaaaacataataatagaagactacgagagtgatgggacatag
Sequence Length
2013
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,156 Da
NCBI Official Full Name
Homo sapiens RAD17 homolog (S. pombe), mRNA
NCBI Official Synonym Full Names
RAD17 checkpoint clamp loader component
NCBI Official Symbol
RAD17
NCBI Official Synonym Symbols
CCYC; R24L; RAD24; HRAD17; RAD17SP
NCBI Protein Information
cell cycle checkpoint protein RAD17
UniProt Protein Name
Cell cycle checkpoint protein RAD17
Protein Family
UniProt Gene Name
RAD17
UniProt Synonym Gene Names
R24L; hRad17
UniProt Entry Name
RAD17_HUMAN

NCBI Description

The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]

Uniprot Description

RAD17: a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. Shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. Binds to chromatin prior to DNA damage and is phosphorylated by ATR after the damage. Phosphorylated and activated after DNA damage, inducing cell cycle G2 arrest. Eight alternatively spliced variants have been reported.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 5q13

Cellular Component: chromosome, telomeric region; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: DNA damage checkpoint; DNA replication; DNA replication checkpoint; mitotic cell cycle checkpoint; negative regulation of DNA replication; regulation of phosphorylation; response to DNA damage stimulus

Research Articles on RAD17

Similar Products

Product Notes

The RAD17 rad17 (Catalog #AAA1265687) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcagg taacagactg ggttgaccca tcatttgatg attttctaga gtgtagtggc gtctctacta ttactgccac atcattaggt gtgaataact caagtcatag aagaaaaaat gggccttcta cattagaaag cagcagattt ccagcgagaa aaagaggaaa tctatcttcc ttagaacaga tttatggttt agaaaattca aaagaatatc tgtctgaaaa tgaaccatgg gtggataaat ataaaccaga aactcagcat gaacttgctg tgcataaaaa gaaaattgaa gaagtcgaaa cctggttaaa agctcaagtt ttagaaaggc aaccaaaaca gggtggatct attttattaa taacaggtcc tcctggatgt ggaaagacaa cgaccttaaa aatactatca aaggagcatg gtattcaagt acaagagtgg attaatccag ttttaccaga cttccaaaaa gatgatttca aggggatgtt taatactgaa tcaagcttcc atatgtttcc ctatcagtct cagatagcag ttttcaaaga gtttctacta agagcgacaa agtataacaa gttacaaatg cttggagatg atctgagaac tgataagaag ataattctgg ttgaagattt acctaaccag ttttatcggg attctcatac tttacatgaa gttctaagga agtatgtgag gattggtcga tgtcctctta tatttataat ctcggacagt ctcagtggag ataataatca aaggttattg tttcccaaag aaattcagga agagtgttct atctcaaata ttagtttcaa ccctgtggca ccaacaatta tgatgaaatt tcttaatcga atagtgacta tagaagctaa caagaatgga ggaaaaatta ctgtccctga caaaacttct ctagagttgc tctgtcaggg atgttctggt gatatcagaa gtgcaataaa cagcctccag ttttcttctt caaaaggaga aaacaactta cggccaagga aaaaaggaat gtctttaaaa tcagatgctg tgctgtcaaa atcaaaacga agaaaaaaac ctgatagggt ttttgaaaat caagaggtcc aagctattgg tggcaaagat gtttctctgt ttctcttcag agctttgggg aaaattctat attgtaaaag agcatcttta acagaattag actcacctcg gttgccctct catttatcag aatatgaacg ggatacatta cttgttgaac ctgaggaggt agtagaaatg tcacacatgc ctggagactt atttaattta tatcttcacc aaaactacat agatttcttc atggaaattg atgatattgt gagagccagt gaatttctga gttttgcaga tatcctcagt ggtgactgga atacacgctc tttactcagg gaatatagca catctatagc tacgagaggt gtgatgcatt ccaacaaagc ccgaggatat gctcattgcc aaggaggagg atcaagtttt cgacccttgc acaaacctca gtggtttcta ataaataaaa agtatcggga aaattgcctg gcagcaaaag cactttttcc tgacttctgc ctaccagctt tatgccgcca aactcagcta ttgccatacc ttgctctact aaccattcca atgagaaatc aagctcagat ttcttttatc caagatattg gaaggctccc tctgaagcga cactttggaa gattgaaaat ggaagccctg actgacaggg aacatggaat gatagaccct gacagcggag atgaagccca gcttaatgga ggacattctg cagaggaatc tctgggtgaa cccactcaag ccactgtgcc ggaaacctgg tctcttcctt tgagtcagaa tagtgccagt gaactgcctg ctagccagcc ccagcccttt tcagcccaag gagacatgga agaaaacata ataatagaag actacgagag tgatgggaca tag. It is sometimes possible for the material contained within the vial of "RAD17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.