Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAC1 cdna clone

RAC1 cDNA Clone

Gene Names
RAC1; MIG5; Rac-1; TC-25; p21-Rac1
Synonyms
RAC1; RAC1 cDNA Clone; RAC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggccatcaagtgtgtggtggtgggagacggagctgtaggtaaaacttgcctactgatcagttacacaaccaatgcatttcctggagaatatatccctactgtctttgacaattattctgccaatgttatggtagatggaaaaccggtgaatctgggcttatgggatacagctggacaagaagattatgacagattacgccccctatcctatccgcaaacagatgtgttcttaatttgcttttcccttgtgagtcctgcatcatttgaaaatgtccgtgcaaagtggtatcctgaggtgcggcaccactgtcccaacactcccatcatcctagtgggaactaaacttgatcttagggatgataaagacacgatcgagaaactgaaggagaagaagctgactcccatcacctatccgcagggtctagccatggctaaggagattggtgctgtaaaatacctggagtgctcggcgctcacacagcgaggcctcaagacagtgtttgacgaagcgatccgagcagtcctctgcccgcctcccgtgaagaagaggaagagaaaatgcctgctgttgtaa
Sequence Length
579
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,467 Da
NCBI Official Full Name
Homo sapiens ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1), mRNA
NCBI Official Synonym Full Names
ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
NCBI Official Symbol
RAC1
NCBI Official Synonym Symbols
MIG5; Rac-1; TC-25; p21-Rac1
NCBI Protein Information
ras-related C3 botulinum toxin substrate 1
UniProt Protein Name
Ras-related C3 botulinum toxin substrate 1
Protein Family
UniProt Gene Name
RAC1
UniProt Synonym Gene Names
TC25
UniProt Entry Name
RAC1_HUMAN

NCBI Description

The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

RAC1: a plasma membrane-associated member of the Rho-GTPase family. Plays a key role in cytoskeletal reorganization, membrane trafficking, transcriptional regulation and cell growth and development. GTP binding stimulates its activity. Phosphorylation by Akt may inhibit GTP binding of Rac1, therefore attenuating the downstream signal transduction pathway. Found in a trimeric complex composed of DOCK1 and ELMO1, which plays a central role in phagocytosis of apoptotic cells. Two alternatively spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; G protein, monomeric, Rho; G protein; G protein, monomeric

Chromosomal Location of Human Ortholog: 7p22

Cellular Component: actin filament; cytoplasm; cytosol; endoplasmic reticulum membrane; extracellular matrix; focal adhesion; lamellipodium; membrane; plasma membrane; trans-Golgi network

Molecular Function: enzyme binding; GTP binding; GTPase activity; protein binding; Rho GDP-dissociation inhibitor binding; thioesterase binding

Biological Process: actin cytoskeleton organization and biogenesis; actin filament polymerization; anatomical structure morphogenesis; blood coagulation; cell adhesion; cell motility; cell motility involved in cell locomotion; ephrin receptor signaling pathway; inflammatory response; lamellipodium biogenesis; localization within membrane; negative regulation of interleukin-23 production; negative regulation of receptor-mediated endocytosis; platelet activation; positive regulation of apoptosis; positive regulation of focal adhesion formation; positive regulation of protein amino acid phosphorylation; positive regulation of Rho protein signal transduction; positive regulation of stress fiber formation; regulation of cell migration; regulation of cell size; regulation of defense response to virus by virus; regulation of hydrogen peroxide metabolic process; regulation of small GTPase mediated signal transduction; response to wounding; ruffle organization and biogenesis; T cell costimulation; vascular endothelial growth factor receptor signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on RAC1

Similar Products

Product Notes

The RAC1 rac1 (Catalog #AAA1269588) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggcca tcaagtgtgt ggtggtggga gacggagctg taggtaaaac ttgcctactg atcagttaca caaccaatgc atttcctgga gaatatatcc ctactgtctt tgacaattat tctgccaatg ttatggtaga tggaaaaccg gtgaatctgg gcttatggga tacagctgga caagaagatt atgacagatt acgcccccta tcctatccgc aaacagatgt gttcttaatt tgcttttccc ttgtgagtcc tgcatcattt gaaaatgtcc gtgcaaagtg gtatcctgag gtgcggcacc actgtcccaa cactcccatc atcctagtgg gaactaaact tgatcttagg gatgataaag acacgatcga gaaactgaag gagaagaagc tgactcccat cacctatccg cagggtctag ccatggctaa ggagattggt gctgtaaaat acctggagtg ctcggcgctc acacagcgag gcctcaagac agtgtttgac gaagcgatcc gagcagtcct ctgcccgcct cccgtgaaga agaggaagag aaaatgcctg ctgttgtaa. It is sometimes possible for the material contained within the vial of "RAC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.