Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB8B cdna clone

RAB8B cDNA Clone

Synonyms
RAB8B; RAB8B cDNA Clone; RAB8B cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaagacgtacgattatctcttcaagctcctgctgatcggcgactcgggggtaggcaagacctgcctcctgttccgcttctcagaggacgccttcaacaccaccttcatctccaccatcggaattgattttaaaattagaacgatagaactagatggaaagaaaattaagcttcagatatgggacacagcgggtcaggaaagattccgaacaatcacgacagcgtactacagaggagccatgggcattatgctggtctatgacatcacaaatgaaaaatcctttgacaatattaaaaattggatcagaaacattgaagagcatgcctcttccgatgtcgaaagaatgatcctgggtaacaaatgtgatatgaatgacaaaagacaagtgtcaaaagaaagaggggagaagctagcaattgactatgggattaaattcttggagacaagcgcaaaatccagtgcaaatgtagaagaggcattttttacacttgcacgagatataatgacaaaactcaacagaaaaatgaatgacagcaattcagcaggagcaggtggaccagtgaaaataacagaaaaccgatcaaagaagaccagtttctttcgttgctcgctactttga
Sequence Length
624
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,584 Da
NCBI Official Full Name
Homo sapiens RAB8B, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB8B, member RAS oncogene family
NCBI Official Symbol
RAB8B
NCBI Protein Information
ras-related protein Rab-8B
UniProt Protein Name
Ras-related protein Rab-8B
Protein Family
UniProt Gene Name
RAB8B
UniProt Entry Name
RAB8B_HUMAN

NCBI Description

RAB proteins, like RAB8B, are low molecular mass monomeric GTPases that localize on the cytoplasmic surfaces of distinct membrane-bound organelles. RAB proteins function in intracellular vesicle transport by aiding in the docking and/or fusion of vesicles with their target membranes (summary by Chen et al., 1997 [PubMed 9030196]).[supplied by OMIM, Nov 2010]

Uniprot Description

RAB8B: May be involved in vesicular trafficking and neurotransmitter release. May participate in cell junction dynamics in Sertoli cells. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein; G protein, monomeric; Motility/polarity/chemotaxis; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 15q22.2

Cellular Component: peroxisomal membrane; phagocytic vesicle

Molecular Function: GDP binding; protein binding; receptor binding

Biological Process: antigen processing and presentation; cilium biogenesis; protein import into peroxisome membrane; protein secretion; vesicle docking during exocytosis

Research Articles on RAB8B

Similar Products

Product Notes

The RAB8B rab8b (Catalog #AAA1271905) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaaga cgtacgatta tctcttcaag ctcctgctga tcggcgactc gggggtaggc aagacctgcc tcctgttccg cttctcagag gacgccttca acaccacctt catctccacc atcggaattg attttaaaat tagaacgata gaactagatg gaaagaaaat taagcttcag atatgggaca cagcgggtca ggaaagattc cgaacaatca cgacagcgta ctacagagga gccatgggca ttatgctggt ctatgacatc acaaatgaaa aatcctttga caatattaaa aattggatca gaaacattga agagcatgcc tcttccgatg tcgaaagaat gatcctgggt aacaaatgtg atatgaatga caaaagacaa gtgtcaaaag aaagagggga gaagctagca attgactatg ggattaaatt cttggagaca agcgcaaaat ccagtgcaaa tgtagaagag gcatttttta cacttgcacg agatataatg acaaaactca acagaaaaat gaatgacagc aattcagcag gagcaggtgg accagtgaaa ataacagaaa accgatcaaa gaagaccagt ttctttcgtt gctcgctact ttga. It is sometimes possible for the material contained within the vial of "RAB8B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.