Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB5C cdna clone

RAB5C cDNA Clone

Gene Names
RAB5C; RABL; L1880; RAB5L; RAB5CL
Synonyms
RAB5C; RAB5C cDNA Clone; RAB5C cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCGGGTCGGGGAGGCGCAGCACGACCCAATGGACCAGCTGCTGGGAACAAGATCTGTCAATTTAAGCTGGTTCTGCTGGGGGAGTCTGCGGTAGGCAAATCCAGCCTCGTCCTCCGCTTTGTCAAGGGACAGTTTCACGAGTACCAGGAGAGCACAATTGGAGCGGCCTTCCTCACACAGACTGTCTGCCTGGATGACACAACAGTCAAGTTTGAGATCTGGGACACAGCTGGACAGGAGCGGTATCACAGCCTGGCCCCCATGTACTATCGGGGGGCCCAGGCTGCCATCGTGGTCTATGACATCACCAACACAGATACATTTGCACGGGCCAAGAACTGGGTGAAGGAGCTACAGAGGCAGGCCAGCCCCAACATCGTCATTGCACTCGCGGGTAACAAGGCAGACCTGGCCAGCAAGAGAGCCGTGGAATTCCAGGAAGCACAAGCCTATGCAGACGACAACAGTTTGCTGTTCATGGAGACATCAGCAAAGACTGCAATGAACGTGAACGAAATCTTCATGGCAATAGCTAAGAAGCTTCCCAAGAACGAGCCCCAGAATGCAACTGGTGCTCCAGGCCGAAACCGAGGTGTGGACCTCCAGGAGAACAACCCAGCCAGCCGGAGCCAGTGCTGCAGCAACTGA
Sequence Length
651
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,036 Da
NCBI Official Full Name
Homo sapiens RAB5C, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB5C, member RAS oncogene family
NCBI Official Symbol
RAB5C
NCBI Official Synonym Symbols
RABL; L1880; RAB5L; RAB5CL
NCBI Protein Information
ras-related protein Rab-5C
UniProt Protein Name
Ras-related protein Rab-5C
Protein Family
UniProt Gene Name
RAB5C
UniProt Synonym Gene Names
RABL
UniProt Entry Name
RAB5C_HUMAN

NCBI Description

Members of the Rab protein family are small GTPases of the Ras superfamily that are thought to ensure fidelity in the process of docking and/or fusion of vesicles with their correct acceptor compartment (Han et al., 1996 [PubMed 8646882]).[supplied by OMIM, Nov 2010]

Uniprot Description

RAB5C: Protein transport. Probably involved in vesicular traffic. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein; G protein, monomeric, Rab; G protein, monomeric; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17q21.2

Cellular Component: early endosome; endocytic vesicle; intracellular membrane-bound organelle; lipid particle; lysosomal membrane; plasma membrane

Molecular Function: GDP binding; GTPase activity; protein binding

Biological Process: plasma membrane to endosome transport; regulation of endocytosis

Research Articles on RAB5C

Similar Products

Product Notes

The RAB5C rab5c (Catalog #AAA1278375) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCGGGTC GGGGAGGCGC AGCACGACCC AATGGACCAG CTGCTGGGAA CAAGATCTGT CAATTTAAGC TGGTTCTGCT GGGGGAGTCT GCGGTAGGCA AATCCAGCCT CGTCCTCCGC TTTGTCAAGG GACAGTTTCA CGAGTACCAG GAGAGCACAA TTGGAGCGGC CTTCCTCACA CAGACTGTCT GCCTGGATGA CACAACAGTC AAGTTTGAGA TCTGGGACAC AGCTGGACAG GAGCGGTATC ACAGCCTGGC CCCCATGTAC TATCGGGGGG CCCAGGCTGC CATCGTGGTC TATGACATCA CCAACACAGA TACATTTGCA CGGGCCAAGA ACTGGGTGAA GGAGCTACAG AGGCAGGCCA GCCCCAACAT CGTCATTGCA CTCGCGGGTA ACAAGGCAGA CCTGGCCAGC AAGAGAGCCG TGGAATTCCA GGAAGCACAA GCCTATGCAG ACGACAACAG TTTGCTGTTC ATGGAGACAT CAGCAAAGAC TGCAATGAAC GTGAACGAAA TCTTCATGGC AATAGCTAAG AAGCTTCCCA AGAACGAGCC CCAGAATGCA ACTGGTGCTC CAGGCCGAAA CCGAGGTGTG GACCTCCAGG AGAACAACCC AGCCAGCCGG AGCCAGTGCT GCAGCAACTG A. It is sometimes possible for the material contained within the vial of "RAB5C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.