Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB41 cdna clone

RAB41 cDNA Clone

Synonyms
RAB41; RAB41 cDNA Clone; RAB41 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgcctttggtcacgacgaggcctggatggaggccggaggctttggtctggaggctgccgaaagaacggaataccagtctctgtgcaaatctaaactcttattcctgggagagcagagcgggaagacatccatcatcagccgcttcatgtacaacagcttcggctgcgcctgccaggcaactgttggaattgacttcttgtctaagaccatgtacttggaggaccaaatagttcagctgcagctatgggacacagctggccaggagcgctttcacagcctaattcctagctacattcgtgattcaactattgcagtggttgtctatgacattacaaacatcaattcttttaaggagacagataagtgggtagaacacgtgcgagcagaaagaggtgacgatgttgtcatcatgttgttgggtaacaagattgatttggataacaaaagacaagtcactgcagaacagggtgaagaaaaatccagaaacctcaatgtgatgtttattgagaccagtgccaaaaccggttacaacgtgaaaaagctgttccggcgtgtggcttctgcccttctttccacaaggacttcacctccaccaaaagaggggacggttgaaatcgaactggaatccttcgaggagtcaggcaacagaagctattgttga
Sequence Length
666
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,939 Da
NCBI Official Full Name
Homo sapiens RAB41, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB41, member RAS oncogene family
NCBI Official Symbol
RAB41
NCBI Protein Information
ras-related protein Rab-41
UniProt Protein Name
Ras-related protein Rab-41
Protein Family
UniProt Gene Name
RAB41
UniProt Entry Name
RAB41_HUMAN

NCBI Description

This gene encodes a small GTP-binding protein that belongs to the largest family within the Ras superfamily. These proteins function as regulators of membrane trafficking. They cycle between inactive GDP-bound and activated GTP-bound states, which is controlled by GTP hydrolysis-activating proteins (GAPs). This family member can be activated by the GAP protein RN-Tre, and it is localized to the Golgi complex. [provided by RefSeq, May 2010]

Uniprot Description

RAB41: a small GTP-binding protein that belongs to the largest family within the Ras superfamily. These proteins function as regulators of membrane trafficking. They cycle between inactive GDP-bound and activated GTP-bound states, which is controlled by GTP hydrolysis-activating proteins (GAPs). This family member can be activated by the GAP protein RN-Tre, and it is localized to the Golgi complex. [provided by RefSeq, May 2010]

Protein type: G protein, monomeric, Rab; G protein; G protein, monomeric

Chromosomal Location of Human Ortholog: Xq13.1

Cellular Component: Golgi apparatus; Golgi membrane

Molecular Function: protein binding

Biological Process: intra-Golgi vesicle-mediated transport; retrograde transport, endosome to Golgi; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on RAB41

Similar Products

Product Notes

The RAB41 rab41 (Catalog #AAA1266981) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgcct ttggtcacga cgaggcctgg atggaggccg gaggctttgg tctggaggct gccgaaagaa cggaatacca gtctctgtgc aaatctaaac tcttattcct gggagagcag agcgggaaga catccatcat cagccgcttc atgtacaaca gcttcggctg cgcctgccag gcaactgttg gaattgactt cttgtctaag accatgtact tggaggacca aatagttcag ctgcagctat gggacacagc tggccaggag cgctttcaca gcctaattcc tagctacatt cgtgattcaa ctattgcagt ggttgtctat gacattacaa acatcaattc ttttaaggag acagataagt gggtagaaca cgtgcgagca gaaagaggtg acgatgttgt catcatgttg ttgggtaaca agattgattt ggataacaaa agacaagtca ctgcagaaca gggtgaagaa aaatccagaa acctcaatgt gatgtttatt gagaccagtg ccaaaaccgg ttacaacgtg aaaaagctgt tccggcgtgt ggcttctgcc cttctttcca caaggacttc acctccacca aaagagggga cggttgaaat cgaactggaa tccttcgagg agtcaggcaa cagaagctat tgttga. It is sometimes possible for the material contained within the vial of "RAB41, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.