Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB3IP cdna clone

RAB3IP cDNA Clone

Gene Names
RAB3IP; RABIN3; RABIN8
Synonyms
RAB3IP; RAB3IP cDNA Clone; RAB3IP cdna clone
Ordering
For Research Use Only!
Sequence
atggctaatgatcccttggaaggcttccatgaagtaaaccttgcttcacctacttctccggaccttcttggtgtgtatgaatcaggaactcaagagcagactacctcaccaagtgtcatctaccggccacacccttcagctttatcctctgtacctatccaggcaaatgcattagatgtttctgaacttcctacacaacccgtgtattcatcccccagacgtttaaattgtgcggaaatatctagtatcagctttcatgttacagacccagccccttgctctacctctggagtcacagctggattaactaaattaactacaagaaaggacaactataatgcagagagagagtttttacagggtgctactataacagaggcttgcgatggcagtgatgatatttttgggttgagtactgatagtctgtctcgtttacgaagccaatctgttttggaagttagagaaaagggctatgaacgattaaaagaagaactcgcaaaagctcagagggaactgaagttaaaagatgaagaatgtgagaggctttcaaaagtgcgagatcaacttggacaggaattggaagaactcacagctagtctatttgaggaagctcataaaatggtgagagaagcaaatatcaagcaggcaacagcagaaaaacagctaaaagaagcacaaggaaaaattgatgtacttcaagctgaagtagctgcattgaagacacttgtattgtccagttctccaacatcacctacgcaggagcctttgccaggtggaaagacaccttttaaaaaggggcatacaagaaataaaagcacaagcagtgctatgagtggcagtcatcaggacctcagtgtgatacagccaattgtaaaagactgcaaagaggtaactcatcaaggactgtcccctctgactctgttgatacttgttagttctcatcactga
Sequence Length
948
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,642 Da
NCBI Official Full Name
Homo sapiens RAB3A interacting protein (rabin3), mRNA
NCBI Official Synonym Full Names
RAB3A interacting protein
NCBI Official Symbol
RAB3IP
NCBI Official Synonym Symbols
RABIN3; RABIN8
NCBI Protein Information
rab-3A-interacting protein
UniProt Protein Name
Rab-3A-interacting protein
UniProt Gene Name
RAB3IP
UniProt Synonym Gene Names
Rab3A-interacting protein
UniProt Entry Name
RAB3I_HUMAN

Uniprot Description

RAB3IP: Guanine nucleotide exchange factor for RAB8A. Mediates the release of GDP from RAB8A but not from RAB3A or RAB5. Modulates actin organization and promotes polarized transport of RAB8A-specific vesicles to the cell surface. Together with RAB11A, RAB8A, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis. Belongs to the SEC2 family. 8 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; GEFs, Rab

Chromosomal Location of Human Ortholog: 12q15

Cellular Component: cytosol; nucleus

Molecular Function: protein binding; Rab guanyl-nucleotide exchange factor activity

Biological Process: protein targeting to membrane

Research Articles on RAB3IP

Similar Products

Product Notes

The RAB3IP rab3ip (Catalog #AAA1275061) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaatg atcccttgga aggcttccat gaagtaaacc ttgcttcacc tacttctccg gaccttcttg gtgtgtatga atcaggaact caagagcaga ctacctcacc aagtgtcatc taccggccac acccttcagc tttatcctct gtacctatcc aggcaaatgc attagatgtt tctgaacttc ctacacaacc cgtgtattca tcccccagac gtttaaattg tgcggaaata tctagtatca gctttcatgt tacagaccca gccccttgct ctacctctgg agtcacagct ggattaacta aattaactac aagaaaggac aactataatg cagagagaga gtttttacag ggtgctacta taacagaggc ttgcgatggc agtgatgata tttttgggtt gagtactgat agtctgtctc gtttacgaag ccaatctgtt ttggaagtta gagaaaaggg ctatgaacga ttaaaagaag aactcgcaaa agctcagagg gaactgaagt taaaagatga agaatgtgag aggctttcaa aagtgcgaga tcaacttgga caggaattgg aagaactcac agctagtcta tttgaggaag ctcataaaat ggtgagagaa gcaaatatca agcaggcaac agcagaaaaa cagctaaaag aagcacaagg aaaaattgat gtacttcaag ctgaagtagc tgcattgaag acacttgtat tgtccagttc tccaacatca cctacgcagg agcctttgcc aggtggaaag acacctttta aaaaggggca tacaagaaat aaaagcacaa gcagtgctat gagtggcagt catcaggacc tcagtgtgat acagccaatt gtaaaagact gcaaagaggt aactcatcaa ggactgtccc ctctgactct gttgatactt gttagttctc atcactga. It is sometimes possible for the material contained within the vial of "RAB3IP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.