Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB35 cdna clone

RAB35 cDNA Clone

Gene Names
RAB35; RAY; H-ray; RAB1C
Synonyms
RAB35; RAB35 cDNA Clone; RAB35 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccgggactacgaccacctcttcaagctgctcatcatcggcgacagcggtgtgggcaagagcagtttactgttgcgttttgcagacaacactttctcaggcagctacatcaccacgatcggagtggatttcaagatccggaccgtggagatcaacggggagaaggtgaagctgcagatctgggacacagcggggcaggagcgcttccgcaccatcacctccacgtattatcgggggacccacggggtcattgtggtttacgacgtcaccagtgccgagtcctttgtcaacgtcaagcggtggcttcacgaaatcaaccagaactgtgatgatgtgtgccgaatattagtgggtaataagaatgacgaccctgagcggaaggtggtggagacggaagatgcctacaaattcgccgggcagatgggcatccagttgttcgagaccagcgccaaggagaatgtcaacgtggaagagatgttcaactgcatcacggagctggtcctccgagcaaagaaagacaacctggcaaaacagcagcagcaacaacagaacgatgtggtgaagctcacgaagaacagtaaacgaaagaaacgctgctgctaa
Sequence Length
606
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,058 Da
NCBI Official Full Name
Homo sapiens RAB35, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB35, member RAS oncogene family
NCBI Official Symbol
RAB35
NCBI Official Synonym Symbols
RAY; H-ray; RAB1C
NCBI Protein Information
ras-related protein Rab-35
UniProt Protein Name
Ras-related protein Rab-35
Protein Family
UniProt Gene Name
RAB35
UniProt Synonym Gene Names
RAB1C; RAY
UniProt Entry Name
RAB35_HUMAN

Uniprot Description

RAB35: In the process of endocytosis, essential rate-limiting regulator of a fast recycling pathway back to the plasma membrane. During cytokinesis, required for the postfurrowing terminal steps, namely for intercellular bridge stability and abscission, possibly by controlling phosphatidylinositol 4,5-bis phosphate (PIP2) and SEPT2 localization at the intercellular bridge. Interacts with DENND1A and DENND1B in a nucleotide- dependent manner. The low binding to DENND1C is nucleotide- independent. All 3 DENND1 act as GEFs for RAB35 and thus activate the protein. Belongs to the small GTPase superfamily. Rab family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein; G protein, monomeric, Rab; G protein, monomeric

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cell projection membrane; clathrin-coated endocytic vesicle; coated pit; endoplasmic reticulum membrane; endosome membrane; Golgi membrane; intercellular bridge; plasma membrane

Molecular Function: GDP binding; GTP binding; GTPase activity; phosphatidylinositol-4,5-bisphosphate binding; protein binding

Biological Process: antigen processing and presentation; cytokinesis; endocytic recycling; endosome transport; ER to Golgi vesicle-mediated transport; neurite development; plasma membrane to endosome transport; protein localization

Research Articles on RAB35

Similar Products

Product Notes

The RAB35 rab35 (Catalog #AAA1267265) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccggg actacgacca cctcttcaag ctgctcatca tcggcgacag cggtgtgggc aagagcagtt tactgttgcg ttttgcagac aacactttct caggcagcta catcaccacg atcggagtgg atttcaagat ccggaccgtg gagatcaacg gggagaaggt gaagctgcag atctgggaca cagcggggca ggagcgcttc cgcaccatca cctccacgta ttatcggggg acccacgggg tcattgtggt ttacgacgtc accagtgccg agtcctttgt caacgtcaag cggtggcttc acgaaatcaa ccagaactgt gatgatgtgt gccgaatatt agtgggtaat aagaatgacg accctgagcg gaaggtggtg gagacggaag atgcctacaa attcgccggg cagatgggca tccagttgtt cgagaccagc gccaaggaga atgtcaacgt ggaagagatg ttcaactgca tcacggagct ggtcctccga gcaaagaaag acaacctggc aaaacagcag cagcaacaac agaacgatgt ggtgaagctc acgaagaaca gtaaacgaaa gaaacgctgc tgctaa. It is sometimes possible for the material contained within the vial of "RAB35, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.