Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB17 cdna clone

RAB17 cDNA Clone

Synonyms
RAB17; RAB17 cDNA Clone; RAB17 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggtgggcaacaagacggacctcagccaggagcgggaggtgaccttccaggaagggaaggagtttgccgacagccagaagttgctgttcatggaaacttcggccaaactgaaccaccaggtgtcggaggtgttcaatacagtggcccaagagctactgcagagaagcgacgaggagggccaggctctacggggggatgcagctgtggctctgaacaaggggcccgcgaggcaggccaaatgctgcgcccactag
Sequence Length
258
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,394 Da
NCBI Official Full Name
Homo sapiens RAB17, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB17, member RAS oncogene family
NCBI Official Symbol
RAB17
NCBI Protein Information
ras-related protein Rab-17
UniProt Protein Name
Ras-related protein Rab-17
Protein Family
UniProt Gene Name
RAB17
UniProt Entry Name
RAB17_HUMAN

NCBI Description

The Rab subfamily of small GTPases plays an important role in the regulation of membrane trafficking. RAB17 is an epithelial cell-specific GTPase (Lutcke et al., 1993 [PubMed 8486736]).[supplied by OMIM, Oct 2009]

Uniprot Description

RAB17: Might be involved in transcellular transport. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein, monomeric, Rab; G protein, monomeric; G protein

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: apical plasma membrane; basolateral plasma membrane; cell soma; dendrite; early endosome; endocytic vesicle; intracellular; melanosome; plasma membrane; recycling endosome; recycling endosome membrane

Molecular Function: GDP binding; GTPase activity; protein binding

Biological Process: cilium biogenesis; endocytic recycling; establishment of melanosome localization; filopodium formation; immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor; melanosome transport; regulation of dendrite development; regulation of endocytosis; regulation of filopodium formation; regulation of synaptogenesis; transcytosis

Research Articles on RAB17

Similar Products

Product Notes

The RAB17 rab17 (Catalog #AAA1270527) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggtgg gcaacaagac ggacctcagc caggagcggg aggtgacctt ccaggaaggg aaggagtttg ccgacagcca gaagttgctg ttcatggaaa cttcggccaa actgaaccac caggtgtcgg aggtgttcaa tacagtggcc caagagctac tgcagagaag cgacgaggag ggccaggctc tacgggggga tgcagctgtg gctctgaaca aggggcccgc gaggcaggcc aaatgctgcg cccactag. It is sometimes possible for the material contained within the vial of "RAB17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.