Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB14 cdna clone

RAB14 cDNA Clone

Gene Names
RAB14; FBP; RAB-14
Synonyms
RAB14; RAB14 cDNA Clone; RAB14 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaactgcaccatacaactactcttacatctttaaatatattattattggggacatgggagtaggaaaatcttgcttgcttcatcaatttacagaaaaaaaatttatggctgattgtcctcacacaattggtgttgaatttggtacaagaataatcgaagttagtggccaaaaaataaaactgcagatttgggatacggcaggacaggagcgatttagggctgttacacggagctactacagaggagctgcgggagctcttatggtctatgatatcactagaagaagtacatataaccacttaagcagctggttgacagatgcaaggaatctcaccaatccaaatactgtaataattctcataggaaataaagcagatttggaggcacagagagatgttacatatgaagaagccaaacagtttgctgaagaaaatggcttattgttcctcgaagcgagtgcaaaaacgggagagaatgtagaagatgccttccttgaggctgccaagaaaatctatcagaacattcaggatggaagcttggatctgaatgctgctgagtctggtgtacaacacaaaccttcagccccgcagggaggccggctaaccagtgaaccccaaccccagagagaaggctgtggctgctag
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,897 Da
NCBI Official Full Name
Homo sapiens RAB14, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB14, member RAS oncogene family
NCBI Official Symbol
RAB14
NCBI Official Synonym Symbols
FBP; RAB-14
NCBI Protein Information
ras-related protein Rab-14
UniProt Protein Name
Ras-related protein Rab-14
Protein Family
UniProt Gene Name
RAB14
UniProt Entry Name
RAB14_HUMAN

NCBI Description

RAB14 belongs to the large RAB family of low molecular mass GTPases that are involved in intracellular membrane trafficking. These proteins act as molecular switches that flip between an inactive GDP-bound state and an active GTP-bound state in which they recruit downstream effector proteins onto membranes (Junutula et al., 2004 [PubMed 15004230]).[supplied by OMIM, Mar 2009]

Uniprot Description

RAB14: a protein of the GTPase superfamily, Rab family. May be involved in vesicular trafficking and neurotransmitter release. Localized to the inner face of the cell membrane by a lipid-anchor.

Protein type: G protein, monomeric; G protein, monomeric, Rab; G protein

Chromosomal Location of Human Ortholog: 9q33.2

Cellular Component: cytoplasmic vesicle membrane; cytosol; early endosome; Golgi apparatus; Golgi stack; intracellular; intracellular membrane-bound organelle; late endosome; lysosomal membrane; lysosome; nuclear envelope-endoplasmic reticulum network; perinuclear region of cytoplasm; phagocytic vesicle; plasma membrane; recycling endosome; rough endoplasmic reticulum; trans-Golgi network transport vesicle

Molecular Function: GDP binding; GTP binding; GTPase activity; myosin V binding; protein binding

Biological Process: embryonic development; endocytic recycling; fibroblast growth factor receptor signaling pathway; Golgi to endosome transport; regulation of protein localization

Research Articles on RAB14

Similar Products

Product Notes

The RAB14 rab14 (Catalog #AAA1269401) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaactg caccatacaa ctactcttac atctttaaat atattattat tggggacatg ggagtaggaa aatcttgctt gcttcatcaa tttacagaaa aaaaatttat ggctgattgt cctcacacaa ttggtgttga atttggtaca agaataatcg aagttagtgg ccaaaaaata aaactgcaga tttgggatac ggcaggacag gagcgattta gggctgttac acggagctac tacagaggag ctgcgggagc tcttatggtc tatgatatca ctagaagaag tacatataac cacttaagca gctggttgac agatgcaagg aatctcacca atccaaatac tgtaataatt ctcataggaa ataaagcaga tttggaggca cagagagatg ttacatatga agaagccaaa cagtttgctg aagaaaatgg cttattgttc ctcgaagcga gtgcaaaaac gggagagaat gtagaagatg ccttccttga ggctgccaag aaaatctatc agaacattca ggatggaagc ttggatctga atgctgctga gtctggtgta caacacaaac cttcagcccc gcagggaggc cggctaacca gtgaacccca accccagaga gaaggctgtg gctgctag. It is sometimes possible for the material contained within the vial of "RAB14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.