Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

QKI cdna clone

QKI cDNA Clone

Gene Names
QKI; QK; Hqk; QK1; QK3; hqkI
Synonyms
QKI; QKI cDNA Clone; QKI cdna clone
Ordering
For Research Use Only!
Sequence
atggtcggggaaatggaaacgaaggagaagccgaagcccaccccagattacctgatgcagctgatgaacgacaagaagctcatgagcagcctgcccaacttctgcgggatcttcaaccacctcgagcggctgctggacgaagaaattagcagagtacggaaagacatgtacaatgacacattaaatggcagtacagagaaaaggagtgcagaattgcctgatgctgtgggacctattgttcagttacaagagaaactttatgtgcctgtaaaagaatacccagattttaattttgttgggagaatccttggacctagaggacttacagccaaacaacttgaagcagaaaccggatgtaaaatcatggtccgaggcaaaggctcaatgagggataaaaaaaaggaggagcaaaatagaggcaagcccaattgggagcatctaaatgaagatttacatgtactaatcactgtggaagatgctcagaacagagcagaaatcaaattgaagagagcagttgaagaagtgaagaaattattggtacctgcagcagaaggagaagacagcctgaagaagatgcagctgatggagcttgcgattctgaatggcacctacagagatgccaacattaaatcaccagcccttgccttttctcttgcagcaacagcccaggctgctccaaggatcattactgggcctgcgccggttctcccaccagctgccctgcgtactcctacgccagctggccctaccataatgcctttgatcagacaaatacagaccgctgtcatgccaaacggaactcctcacccaactgctgcaatagttcctccagggcccgaagctggtttaatctatacaccctatgagtacccctacacattggcaccagctacatcaatccttgagtatcctattgaacctagtggtgtattaggtgcggtggctactaaagttcgaaggcacgatatgcgtgtccatccttaccaaaggattgtgaccgcagaccgagccgccaccggcaactaa
Sequence Length
1026
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,131 Da
NCBI Official Full Name
Homo sapiens quaking homolog, KH domain RNA binding (mouse), mRNA
NCBI Official Synonym Full Names
QKI, KH domain containing RNA binding
NCBI Official Symbol
QKI
NCBI Official Synonym Symbols
QK; Hqk; QK1; QK3; hqkI
NCBI Protein Information
protein quaking
UniProt Protein Name
Protein quaking
Protein Family
UniProt Gene Name
QKI
UniProt Synonym Gene Names
HKQ; Hqk; HqkI
UniProt Entry Name
QKI_HUMAN

NCBI Description

The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Uniprot Description

QKI: RNA-binding protein that plays a central role in myelinization. Binds to the 5'-NACUAAY-N(1,20)-UAAY-3' RNA core sequence. Acts by regulating pre-mRNA splicing, mRNA export, mRNA stability and protein translation. Required to protect and promote stability of mRNAs such as MBP and CDKN1B. Regulator of oligodendrocyte differentiation and maturation in the brain that may play a role in myelin and oligodendrocyte dysfunction in schizophrenia. Participates in mRNA transport by regulating the nuclear export of MBP mRNA. Also involved in regulation of mRNA splicing of MAG pre-mRNA. Acts as a translational repressor. 6 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 6q26

Molecular Function: protein binding

Research Articles on QKI

Similar Products

Product Notes

The QKI qki (Catalog #AAA1272880) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcgggg aaatggaaac gaaggagaag ccgaagccca ccccagatta cctgatgcag ctgatgaacg acaagaagct catgagcagc ctgcccaact tctgcgggat cttcaaccac ctcgagcggc tgctggacga agaaattagc agagtacgga aagacatgta caatgacaca ttaaatggca gtacagagaa aaggagtgca gaattgcctg atgctgtggg acctattgtt cagttacaag agaaacttta tgtgcctgta aaagaatacc cagattttaa ttttgttggg agaatccttg gacctagagg acttacagcc aaacaacttg aagcagaaac cggatgtaaa atcatggtcc gaggcaaagg ctcaatgagg gataaaaaaa aggaggagca aaatagaggc aagcccaatt gggagcatct aaatgaagat ttacatgtac taatcactgt ggaagatgct cagaacagag cagaaatcaa attgaagaga gcagttgaag aagtgaagaa attattggta cctgcagcag aaggagaaga cagcctgaag aagatgcagc tgatggagct tgcgattctg aatggcacct acagagatgc caacattaaa tcaccagccc ttgccttttc tcttgcagca acagcccagg ctgctccaag gatcattact gggcctgcgc cggttctccc accagctgcc ctgcgtactc ctacgccagc tggccctacc ataatgcctt tgatcagaca aatacagacc gctgtcatgc caaacggaac tcctcaccca actgctgcaa tagttcctcc agggcccgaa gctggtttaa tctatacacc ctatgagtac ccctacacat tggcaccagc tacatcaatc cttgagtatc ctattgaacc tagtggtgta ttaggtgcgg tggctactaa agttcgaagg cacgatatgc gtgtccatcc ttaccaaagg attgtgaccg cagaccgagc cgccaccggc aactaa. It is sometimes possible for the material contained within the vial of "QKI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.