Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PYCR1 cdna clone

PYCR1 cDNA Clone

Gene Names
PYCR1; P5C; P5CR; PRO3; PYCR; PIG45; PP222; ARCL2B; ARCL3B
Synonyms
PYCR1; PYCR1 cDNA Clone; PYCR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgtgggcttcatcggcgctggccagctggcttttgccctggccaagggcttcacagcagcaggcgtcttggctgcccacaagataatggctagctccccagacatggacctggccacagtttctgctctcaggaagatgggggtgaagttgacaccccacaacaaggagacggtgcagcacagtgatgtgctcttcctggctgtgaagccacacatcatccccttcatcctggatgaaataggcgccgacattgaggacagacacattgtggtgtcctgcgcggccggcgtcaccatcagctccattgagaagaagctgtcagcgtttcggccagcccccagggtcatccgctgcatgaccaacactccagtcgtggtgcgggagggggccaccgtgtatgccacaggcacgcacgcccaggtggaggacgggaggctcatggagcagctgctgagcagcgtgggcttctgcacggaggtggaagaggacctgattgatgccgtcacggggctcagtggcagcggccccgcctacgcattcacagccctggatgccctggctgatgggggcgtgaagatgggacttccaaggcgcctggcagtccgcctcggggcccaggccctcctgggggctgccaagatgctgctgcactcagaacagcacccaggccagctcaaggacaacgtcagctctcctggtggggccaccatccatgccttgcatgtgctggagagtgggggcttccgctccctgctcatcaacgctgtggaggcctcctgcatccgcacacgggagctgcagtccatggctgaccaggagcaggtgtcaccagccgccatcaagaagaccatcctggacaaggtgaagctggactcccctgcagggaccgctctgtcgccttctggccacaccaagctgctcccccgcagcctggccccagcgggcaaggattga
Sequence Length
960
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Related Product Information for PYCR1 cdna clone
Homo sapiens pyrroline-5-carboxylate reductase 1, mRNA

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
33,361 Da
NCBI Official Full Name
Homo sapiens pyrroline-5-carboxylate reductase 1, mRNA
NCBI Official Synonym Full Names
pyrroline-5-carboxylate reductase 1
NCBI Official Symbol
PYCR1
NCBI Official Synonym Symbols
P5C; P5CR; PRO3; PYCR; PIG45; PP222; ARCL2B; ARCL3B
NCBI Protein Information
pyrroline-5-carboxylate reductase 1, mitochondrial; P5CR 1; P5C reductase 1; proliferation-inducing protein 45; mitochondrial pyrroline-5-carboxylate reductase 1
UniProt Protein Name
Pyrroline-5-carboxylate reductase 1, mitochondrial
UniProt Gene Name
PYCR1
UniProt Synonym Gene Names
P5C reductase 1; P5CR 1
UniProt Entry Name
P5CR1_HUMAN

NCBI Description

This gene encodes an enzyme that catalyzes the NAD(P)H-dependent conversion of pyrroline-5-carboxylate to proline. This enzyme may also play a physiologic role in the generation of NADP(+) in some cell types. The protein forms a homopolymer and localizes to the mitochondrion. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

PYCR1: Housekeeping enzyme that catalyzes the last step in proline biosynthesis. Can utilize both NAD and NADP, but has higher affinity for NAD. Involved in the cellular response to oxidative stress. Defects in PYCR1 are the cause of cutis laxa autosomal recessive type 2B (ARCL2B). A multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin with reduced elasticity, joint laxity, craniofacial dysmorphic features, intrauterine growth retardation with some degree of postnatal growth deficiency, and developmental delay. Defects in PYCR1 are the cause of cutis laxa, autosomal recessive, type 3B (ARCL3B). ARCL3B is a disorder characterized by an aged appearance with distinctive facial features, sparse hair, ophthalmologic abnormalities, intrauterine growth retardation, and cutis laxa. Belongs to the pyrroline-5-carboxylate reductase family.

Protein type: Amino Acid Metabolism - arginine and proline; Oxidoreductase; Mitochondrial; EC 1.5.1.2

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: mitochondrion; mitochondrial matrix

Molecular Function: identical protein binding; protein binding; pyrroline-5-carboxylate reductase activity

Biological Process: regulation of mitochondrial membrane potential; proline biosynthetic process; amino acid biosynthetic process

Disease: Cutis Laxa, Autosomal Recessive, Type Iib; Cutis Laxa, Autosomal Recessive, Type Iiib

Research Articles on PYCR1

Similar Products

Product Notes

The PYCR1 pycr1 (Catalog #AAA1266775) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgtgg gcttcatcgg cgctggccag ctggcttttg ccctggccaa gggcttcaca gcagcaggcg tcttggctgc ccacaagata atggctagct ccccagacat ggacctggcc acagtttctg ctctcaggaa gatgggggtg aagttgacac cccacaacaa ggagacggtg cagcacagtg atgtgctctt cctggctgtg aagccacaca tcatcccctt catcctggat gaaataggcg ccgacattga ggacagacac attgtggtgt cctgcgcggc cggcgtcacc atcagctcca ttgagaagaa gctgtcagcg tttcggccag cccccagggt catccgctgc atgaccaaca ctccagtcgt ggtgcgggag ggggccaccg tgtatgccac aggcacgcac gcccaggtgg aggacgggag gctcatggag cagctgctga gcagcgtggg cttctgcacg gaggtggaag aggacctgat tgatgccgtc acggggctca gtggcagcgg ccccgcctac gcattcacag ccctggatgc cctggctgat gggggcgtga agatgggact tccaaggcgc ctggcagtcc gcctcggggc ccaggccctc ctgggggctg ccaagatgct gctgcactca gaacagcacc caggccagct caaggacaac gtcagctctc ctggtggggc caccatccat gccttgcatg tgctggagag tgggggcttc cgctccctgc tcatcaacgc tgtggaggcc tcctgcatcc gcacacggga gctgcagtcc atggctgacc aggagcaggt gtcaccagcc gccatcaaga agaccatcct ggacaaggtg aagctggact cccctgcagg gaccgctctg tcgccttctg gccacaccaa gctgctcccc cgcagcctgg ccccagcggg caaggattga. It is sometimes possible for the material contained within the vial of "PYCR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.