Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PUF60 cdna clone

PUF60 cDNA Clone

Gene Names
PUF60; FIR; VRJS; RoBPI; SIAHBP1
Synonyms
PUF60; PUF60 cDNA Clone; PUF60 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaacgggcagagcacagccgccaagctggggctgcctcccctgacgcccgagcagcaggaggcccttcagaaggccaagaagtacgccatggagcagagcatcaagagtgtgctggtgaagcagaccatcgcgcaccagcagcagcagctcaccaacctgcagatggcagcagtgacaatgggctttggagatcctctctcacctttgcaatcgatggcggctcagcggcagcgggcgctggccatcatgtgccgcgtctacgtgggctctatctactatgagctgggggaggacaccatccgccaggcctttgccccctttggccccatcaagagcatcgacatgtcctgggactccgtcaccatgaagcacaagggctttgccttcgtggagtatgaggtccccgaagctgcacagctggccttggagcagatgaactcggtgatgctggggggcaggaacatcaaggtgggcagacccagcaacatagggcaggcccagcccatcatagaccagttggctgaggaggcacgggccttcaaccgcatctacgtggcctctgtgcaccaggacctctcagacgatgacatcaagagcgtgtttgaggcctttggcaagatcaagtcctgcacactggcccgggaccccacaactggcaagcacaagggctacggcttcattgagtacgagaaggcccagtcgtcccaagatgctgtgtcttccatgaacctctttgacctgggtggccagtacttgcgggtgggcaaggctgtcacaccgcccatgcccctactcacaccagccacgcctggaggcctcccacctgccgctgctgtggcagctgctgcagccactgccaagatcacagctcaggaagcagtggccggagcagcggtgctgggtaccctgggcacacctggactggtgtccccagcactgaccctggcccagcccctgggcactttgccccaggctgtcatggctgcccaggcacctggagtcatcacaggtgtgaccccagcccgtcctcctatcccggtcaccatcccctcggtgggagtggtgaaccccatcctggccagccctccaacgctgggtctcctggagcccaagaaggagaaggaagaagaggagctgtttcccgagtcagagcggccagagatgctgagcgagcaggagcacatgagcatctcgggcagtagcgcccgacacatggtgatgcagaagctgctccgcaagcaggagtctacagtgatggttctgcgcaacatggtggaccccaaggacatcgatgatgacctggaaggggaggtgacagaggagtgtggcaagttcggggccgtgaaccgcgtcatcatctaccaagagaaacaaggcgaggaggaggatgcagaaatcattgtcaagatctttgtggagttttccatagcctctgagactcataaggccatccaggccctcaatggccgctggtttgctggccgcaaggtggtggctgaagtgtacgaccaggagcgttttgataacagtgacctctctgcgtga
Sequence Length
1551
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,399 Da
NCBI Official Full Name
Homo sapiens poly-U binding splicing factor 60KDa, mRNA
NCBI Official Synonym Full Names
poly(U) binding splicing factor 60
NCBI Official Symbol
PUF60
NCBI Official Synonym Symbols
FIR; VRJS; RoBPI; SIAHBP1
NCBI Protein Information
poly(U)-binding-splicing factor PUF60
UniProt Protein Name
Poly(U)-binding-splicing factor PUF60
UniProt Gene Name
PUF60
UniProt Synonym Gene Names
FIR; ROBPI; SIAHBP1; FBP-interacting repressor; RoBP1; Siah-BP1
UniProt Entry Name
PUF60_HUMAN

NCBI Description

This gene encodes a nucleic acid-binding protein that plays a role in a variety of nuclear processes, including pre-mRNA splicing and transcriptional regulation. The encoded protein forms a complex with the far upstream DNA element (FUSE) and FUSE-binding protein at the myelocytomatosis oncogene (MYC) promoter. This complex represses MYC transcription through the core-TFIIH basal transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]

Uniprot Description

FIR: fuse-binding protein-interacting repressor. Interacts with (and may activate) Ro RNPs. Forms a ternary complex with far upstream element (FUSE) and FUSE-binding protein. It can repress a c-myc reporter via the FUSE. It is also known to target transcription factor IIH and inhibit activated transcription. This gene is implicated in the xeroderma pigmentosum disorder. Two alternatively spliced isoforms have been described.

Protein type: Spliceosome; RNA-binding; RNA splicing; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: cell junction; cell-cell adherens junction; cyclin-dependent protein kinase activating kinase holoenzyme complex; nucleoplasm

Molecular Function: identical protein binding; protein binding

Disease: Verheij Syndrome

Research Articles on PUF60

Similar Products

Product Notes

The PUF60 puf60 (Catalog #AAA1275471) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaacg ggcagagcac agccgccaag ctggggctgc ctcccctgac gcccgagcag caggaggccc ttcagaaggc caagaagtac gccatggagc agagcatcaa gagtgtgctg gtgaagcaga ccatcgcgca ccagcagcag cagctcacca acctgcagat ggcagcagtg acaatgggct ttggagatcc tctctcacct ttgcaatcga tggcggctca gcggcagcgg gcgctggcca tcatgtgccg cgtctacgtg ggctctatct actatgagct gggggaggac accatccgcc aggcctttgc cccctttggc cccatcaaga gcatcgacat gtcctgggac tccgtcacca tgaagcacaa gggctttgcc ttcgtggagt atgaggtccc cgaagctgca cagctggcct tggagcagat gaactcggtg atgctggggg gcaggaacat caaggtgggc agacccagca acatagggca ggcccagccc atcatagacc agttggctga ggaggcacgg gccttcaacc gcatctacgt ggcctctgtg caccaggacc tctcagacga tgacatcaag agcgtgtttg aggcctttgg caagatcaag tcctgcacac tggcccggga ccccacaact ggcaagcaca agggctacgg cttcattgag tacgagaagg cccagtcgtc ccaagatgct gtgtcttcca tgaacctctt tgacctgggt ggccagtact tgcgggtggg caaggctgtc acaccgccca tgcccctact cacaccagcc acgcctggag gcctcccacc tgccgctgct gtggcagctg ctgcagccac tgccaagatc acagctcagg aagcagtggc cggagcagcg gtgctgggta ccctgggcac acctggactg gtgtccccag cactgaccct ggcccagccc ctgggcactt tgccccaggc tgtcatggct gcccaggcac ctggagtcat cacaggtgtg accccagccc gtcctcctat cccggtcacc atcccctcgg tgggagtggt gaaccccatc ctggccagcc ctccaacgct gggtctcctg gagcccaaga aggagaagga agaagaggag ctgtttcccg agtcagagcg gccagagatg ctgagcgagc aggagcacat gagcatctcg ggcagtagcg cccgacacat ggtgatgcag aagctgctcc gcaagcagga gtctacagtg atggttctgc gcaacatggt ggaccccaag gacatcgatg atgacctgga aggggaggtg acagaggagt gtggcaagtt cggggccgtg aaccgcgtca tcatctacca agagaaacaa ggcgaggagg aggatgcaga aatcattgtc aagatctttg tggagttttc catagcctct gagactcata aggccatcca ggccctcaat ggccgctggt ttgctggccg caaggtggtg gctgaagtgt acgaccagga gcgttttgat aacagtgacc tctctgcgtg a. It is sometimes possible for the material contained within the vial of "PUF60, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.