Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTPRN cdna clone

PTPRN cDNA Clone

Gene Names
PTPRN; IA2; IA-2; ICA512; R-PTP-N; IA-2/PTP
Synonyms
PTPRN; PTPRN cDNA Clone; PTPRN cdna clone
Ordering
For Research Use Only!
Sequence
atggaggggccggtggagggcagagacacagcagagcttccagcccgcacatcccccatgcctggacaccccactgccagccctacctccagtgaagtccagcaggtgccaagccctgtctcctctgagcctcccaaagctgccagaccccctgtgacacctgtcctgctagagaagaaaagcccactgggccagagccagcccacggtggcaggacagccctcagcccgcccagcagcagaggaatatggctacatcgtcactgatcagaagcccctgagcctggctgcaggagtgaagctgctggagatcctggctgagcatgtgcacatgtcctcaggcagcttcatcaacatcagtgtggtgggaccagccctcaccttccgcatccggcacaatgagcagaacctgtctttggctgatgtgacccaacaagcagggctggtgaagtctgaactggaagcacagacagggctccaaatcttgcagacaggagtgggacagagggaggaggcagctgcagtccttccccaaactgcgcacagcacctcacccatgcgctcagtgctgctcactctggtggccctggcaggtgtggctgggctgctggtggctctggctgtggctctgtgtgtgcggcagcatgcgcggcagcaagacaaggagcgcctggcagccctggggcctgagggggcccatggtgacactacctttgagtaccaggacctgtgccgccagcacatggccacgaagtccttgttcaaccgggcagagggtccaccggagccttcacgggtgagcagtgtgtcctcccagttcagcgacgcagcccaggccagccccagctcccacagcagcaccccgtcctggtgcgaggagccggcccaagccaacatggacatctccacgggacacatgattctggcatacatggaggatcacctgcggaaccgggaccgccttgccaaggagtggcaggccctctgtgcctaccaagcagagccaaacacctgtgccaccgcgcagggggagggcaacatcaaaaagaaccggcatcctgacttcctgccctatgaccatgcccgcataaaactgaaggtggagagcagcccttctcggagcgattacatcaacgccagccccattattgagcatgaccctcggatgccagcctacatagccacgcagggcccgctgtcccataccatcgcagacttctggcagatggtgtgggagagcggctgcaccgtcatcgtcatgctgaccccgctggtggaggatggtgtcaagcagtgtgaccgctactggccagatgagggtgcctccctctaccacgtatatgaggtgaacctggtgtcggagcacatctggtgcgaggactttctggtgcggagcttctacctgaagaacgtgcagacccaggagacgcgcacgctcacgcagttccacttcctcagctggccggcagagggcacaccggcctccacgcggcccctgctggacttccgcaggaaggtgaacaagtgctaccggggccgctcctgccccatcatcgtgcactgcagtgatggtgcggggaggaccggcacctacatcctcatcgacatggtcctgaaccgcatggcaaaaggagtgaaggagattgacatcgctgccaccctggagcatgtccgtgaccagcggcctggccttgtccgctctaaggaccagtttgaatttgccctgacagccgtggcggaggaagtgaatgccatcctcaaggccctgccccagtga
Sequence Length
1776
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
96,261 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase, receptor type, N, mRNA
NCBI Official Synonym Full Names
protein tyrosine phosphatase, receptor type N
NCBI Official Symbol
PTPRN
NCBI Official Synonym Symbols
IA2; IA-2; ICA512; R-PTP-N; IA-2/PTP
NCBI Protein Information
receptor-type tyrosine-protein phosphatase-like N
UniProt Protein Name
Receptor-type tyrosine-protein phosphatase-like N
UniProt Gene Name
PTPRN
UniProt Synonym Gene Names
ICA3; ICA512; ICA 512
UniProt Entry Name
PTPRN_HUMAN

NCBI Description

The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]

Uniprot Description

PTPRN: Implicated in neuroendocrine secretory processes. May be involved in processes specific for neurosecretory granules, such as their biogenesis, trafficking or regulated exocytosis or may have a general role in neuroendocrine functions. Seems to lack intrinsic enzyme activity. May play a role in the regulation of secretory granules via its interaction with SNTB2. Belongs to the protein-tyrosine phosphatase family. Receptor class 8 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor protein phosphatase, tyrosine; Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q35-q36.1

Cellular Component: cell soma; endosome; Golgi apparatus; nerve terminal; plasma membrane; secretory granule; synapse; synaptic vesicle

Molecular Function: protein binding; protein tyrosine phosphatase activity; spectrin binding

Biological Process: insulin secretion; luteinization; response to reactive oxygen species

Research Articles on PTPRN

Similar Products

Product Notes

The PTPRN ptprn (Catalog #AAA1277021) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggggc cggtggaggg cagagacaca gcagagcttc cagcccgcac atcccccatg cctggacacc ccactgccag ccctacctcc agtgaagtcc agcaggtgcc aagccctgtc tcctctgagc ctcccaaagc tgccagaccc cctgtgacac ctgtcctgct agagaagaaa agcccactgg gccagagcca gcccacggtg gcaggacagc cctcagcccg cccagcagca gaggaatatg gctacatcgt cactgatcag aagcccctga gcctggctgc aggagtgaag ctgctggaga tcctggctga gcatgtgcac atgtcctcag gcagcttcat caacatcagt gtggtgggac cagccctcac cttccgcatc cggcacaatg agcagaacct gtctttggct gatgtgaccc aacaagcagg gctggtgaag tctgaactgg aagcacagac agggctccaa atcttgcaga caggagtggg acagagggag gaggcagctg cagtccttcc ccaaactgcg cacagcacct cacccatgcg ctcagtgctg ctcactctgg tggccctggc aggtgtggct gggctgctgg tggctctggc tgtggctctg tgtgtgcggc agcatgcgcg gcagcaagac aaggagcgcc tggcagccct ggggcctgag ggggcccatg gtgacactac ctttgagtac caggacctgt gccgccagca catggccacg aagtccttgt tcaaccgggc agagggtcca ccggagcctt cacgggtgag cagtgtgtcc tcccagttca gcgacgcagc ccaggccagc cccagctccc acagcagcac cccgtcctgg tgcgaggagc cggcccaagc caacatggac atctccacgg gacacatgat tctggcatac atggaggatc acctgcggaa ccgggaccgc cttgccaagg agtggcaggc cctctgtgcc taccaagcag agccaaacac ctgtgccacc gcgcaggggg agggcaacat caaaaagaac cggcatcctg acttcctgcc ctatgaccat gcccgcataa aactgaaggt ggagagcagc ccttctcgga gcgattacat caacgccagc cccattattg agcatgaccc tcggatgcca gcctacatag ccacgcaggg cccgctgtcc cataccatcg cagacttctg gcagatggtg tgggagagcg gctgcaccgt catcgtcatg ctgaccccgc tggtggagga tggtgtcaag cagtgtgacc gctactggcc agatgagggt gcctccctct accacgtata tgaggtgaac ctggtgtcgg agcacatctg gtgcgaggac tttctggtgc ggagcttcta cctgaagaac gtgcagaccc aggagacgcg cacgctcacg cagttccact tcctcagctg gccggcagag ggcacaccgg cctccacgcg gcccctgctg gacttccgca ggaaggtgaa caagtgctac cggggccgct cctgccccat catcgtgcac tgcagtgatg gtgcggggag gaccggcacc tacatcctca tcgacatggt cctgaaccgc atggcaaaag gagtgaagga gattgacatc gctgccaccc tggagcatgt ccgtgaccag cggcctggcc ttgtccgctc taaggaccag tttgaatttg ccctgacagc cgtggcggag gaagtgaatg ccatcctcaa ggccctgccc cagtga. It is sometimes possible for the material contained within the vial of "PTPRN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.