Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTPN6 cdna clone

PTPN6 cDNA Clone

Gene Names
PTPN6; HCP; HCPH; SHP1; SHP-1; HPTP1C; PTP-1C; SHP-1L; SH-PTP1
Synonyms
PTPN6; PTPN6 cDNA Clone; PTPN6 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgtcccgtgggtggtttcaccgagacctcagtgggctggatgcagagaccctgctcaagggccgaggtgtccacggtagcttcctggctcggcccagtcgcaagaaccagggtgacttctcgctctccgtcagggtgggggatcaggtgacccatattcggatccagaactcaggggatttctatgacctgtatggaggggagaagtttgcgactctgacagagctggtggagtactacactcagcagcagggtgtcctgcaggaccgcgacggcaccatcatccacctcaagtacccgctgaactgctccgatcccactagtgagaggtggtaccatggccacatgtctggcgggcaggcagagacgctgctgcaggccaagggcgagccctggacgtttcttgtgcgtgagagcctcagccagcctggagacttcgtgctttctgtgctcagtgaccagcccaaggctggcccaggctccccgctcagggtcacccacatcaaggtcatgtgcgagggtggacgctacacagtgggtggtttggagaccttcgacagcctcacggacctggtggagcatttcaagaagacggggattgaggaggcctcaggcgcctttgtctacctgcggcagccgtactatgccacgagggtgaatgcggctgacattgagaaccgagtgttggaactgaacaagaagcaggagtccgaggatacagccaaggctggcttctgggaggagtttgagagtttgcagaagcaggaggtgaagaacttgcaccagcgtctggaagggcagcggccagagaacaagggcaagaaccgctacaagaacattctcccctttgaccacagccgagtgatcctgcagggacgggacagtaacatccccgggtccgactacatcaatgccaactacatcaagaaccagctgctaggccctgatgagaacgctaagacctacatcgccagccagggctgtctggaggccacggtcaatgacttctggcagatggcgtggcaggagaacagccgtgtcatcgtcatgaccacccgagaggtggagaaaggccggaacaaatgcgtcccatactggcccgaggtgggcatgcagcgtgcttatgggccctactctgtgaccaactgcggggagcatgacacaaccgaatacaaactccgtaccttacaggtctccccgctggacaatggagacctgattcgggagatctggcattaccagtacctgagctggcccgaccatggggtccccagtgagcctgggggtgtcctcagcttcctggaccagatcaaccagcggcaggaaagtctgcctcacgcagggcccatcatcgtgcactgcagcgccggcatcggccgcacaggcaccatcattgtcatcgacatgctcatggagaacatctccaccaagggcctggactgtgacattgacatccagaagaccatccagatggtgcgggcgcagcgctcgggcatggtgcagacggaggcgcagtacaagttcatctacgtggccatcgcccagttcattgaaaccactaagaagaagctggaggtcctgcagtcgcagaagggccaggagtcggagtacgggaacatcacctatcccccagccatgaagaatgcccatgccaaggcctcccgcacctcgtccaaacacaaggaggatgtgtatgagaacctgcacactaagaacaagagggaggagaaagtgaagaagcagcggtcagcagacaaggagaagagcaagggttccctcaagaggaagtga
Sequence Length
1794
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,131 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase, non-receptor type 6, mRNA
NCBI Official Synonym Full Names
protein tyrosine phosphatase, non-receptor type 6
NCBI Official Symbol
PTPN6
NCBI Official Synonym Symbols
HCP; HCPH; SHP1; SHP-1; HPTP1C; PTP-1C; SHP-1L; SH-PTP1
NCBI Protein Information
tyrosine-protein phosphatase non-receptor type 6
UniProt Protein Name
Tyrosine-protein phosphatase non-receptor type 6
UniProt Gene Name
PTPN6
UniProt Synonym Gene Names
HCP; PTP1C; PTP-1C
UniProt Entry Name
PTN6_HUMAN

NCBI Description

The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

SHP-1: an SH2-containing ubiquitously expressed tyrosine-specific protein phosphatase. Plays a key role in hematopoiesis. Directly links growth factor receptors and other signaling proteins through protein-tyrosine phosphorylation. The SH2 regions may interact with other cellular components to modulate its own phosphatase activity against interacting substrates. Three alternatively spliced isoforms have been described.

Protein type: EC 3.1.3.48; Motility/polarity/chemotaxis; Protein phosphatase, tyrosine (non-receptor)

Chromosomal Location of Human Ortholog: 12p13

Cellular Component: cytoplasm; cytosol; membrane; nucleolus; nucleus

Molecular Function: protein binding; protein kinase binding; protein tyrosine phosphatase activity; transmembrane receptor protein tyrosine phosphatase activity

Biological Process: apoptosis; cell differentiation; cell proliferation; G-protein coupled receptor protein signaling pathway; leukocyte migration; negative regulation of peptidyl-tyrosine phosphorylation; peptidyl-tyrosine phosphorylation; platelet activation; positive regulation of cell proliferation; positive regulation of phosphoinositide 3-kinase cascade; protein amino acid dephosphorylation; T cell costimulation

Research Articles on PTPN6

Similar Products

Product Notes

The PTPN6 ptpn6 (Catalog #AAA1273593) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtccc gtgggtggtt tcaccgagac ctcagtgggc tggatgcaga gaccctgctc aagggccgag gtgtccacgg tagcttcctg gctcggccca gtcgcaagaa ccagggtgac ttctcgctct ccgtcagggt gggggatcag gtgacccata ttcggatcca gaactcaggg gatttctatg acctgtatgg aggggagaag tttgcgactc tgacagagct ggtggagtac tacactcagc agcagggtgt cctgcaggac cgcgacggca ccatcatcca cctcaagtac ccgctgaact gctccgatcc cactagtgag aggtggtacc atggccacat gtctggcggg caggcagaga cgctgctgca ggccaagggc gagccctgga cgtttcttgt gcgtgagagc ctcagccagc ctggagactt cgtgctttct gtgctcagtg accagcccaa ggctggccca ggctccccgc tcagggtcac ccacatcaag gtcatgtgcg agggtggacg ctacacagtg ggtggtttgg agaccttcga cagcctcacg gacctggtgg agcatttcaa gaagacgggg attgaggagg cctcaggcgc ctttgtctac ctgcggcagc cgtactatgc cacgagggtg aatgcggctg acattgagaa ccgagtgttg gaactgaaca agaagcagga gtccgaggat acagccaagg ctggcttctg ggaggagttt gagagtttgc agaagcagga ggtgaagaac ttgcaccagc gtctggaagg gcagcggcca gagaacaagg gcaagaaccg ctacaagaac attctcccct ttgaccacag ccgagtgatc ctgcagggac gggacagtaa catccccggg tccgactaca tcaatgccaa ctacatcaag aaccagctgc taggccctga tgagaacgct aagacctaca tcgccagcca gggctgtctg gaggccacgg tcaatgactt ctggcagatg gcgtggcagg agaacagccg tgtcatcgtc atgaccaccc gagaggtgga gaaaggccgg aacaaatgcg tcccatactg gcccgaggtg ggcatgcagc gtgcttatgg gccctactct gtgaccaact gcggggagca tgacacaacc gaatacaaac tccgtacctt acaggtctcc ccgctggaca atggagacct gattcgggag atctggcatt accagtacct gagctggccc gaccatgggg tccccagtga gcctgggggt gtcctcagct tcctggacca gatcaaccag cggcaggaaa gtctgcctca cgcagggccc atcatcgtgc actgcagcgc cggcatcggc cgcacaggca ccatcattgt catcgacatg ctcatggaga acatctccac caagggcctg gactgtgaca ttgacatcca gaagaccatc cagatggtgc gggcgcagcg ctcgggcatg gtgcagacgg aggcgcagta caagttcatc tacgtggcca tcgcccagtt cattgaaacc actaagaaga agctggaggt cctgcagtcg cagaagggcc aggagtcgga gtacgggaac atcacctatc ccccagccat gaagaatgcc catgccaagg cctcccgcac ctcgtccaaa cacaaggagg atgtgtatga gaacctgcac actaagaaca agagggagga gaaagtgaag aagcagcggt cagcagacaa ggagaagagc aagggttccc tcaagaggaa gtga. It is sometimes possible for the material contained within the vial of "PTPN6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.