Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTPN23 cdna clone

PTPN23 cDNA Clone

Gene Names
PTPN23; HDPTP; HD-PTP; PTP-TD14
Synonyms
PTPN23; PTPN23 cDNA Clone; PTPN23 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcccccaggcagcccctcttaccattcgagggccctcgtctgctggccagtccacccctagtccccacctggtgccttcacctgccccatctccagggcctggtccggtaccccctcgccccccagcagcagaaccacccccttgcctgcgccgaggcgccgcagctgcagacctgctctcctccagcccggagagccagcatggcggcactcagtctcctgggggtgggcagcccctgctgcagcccaccaaggtggatgcagctgagggtcgtcggccgcaggccctgcggctgattgagcgggacccctatgaacatcctgagaggctgcggcagttgcagcaggagctggaggcctttcggggtcagctgggggatgtgggagctctggacactgtctggcgagagctgcaagatgcgcaggaacatgatgcccgaggccgttccatcgccattgcccgctgctactcactgaagaaccggcaccaggatgtcatgccctatgacagtaaccgtgtggtgctgcgctcaggcaaggatgactacatcaatgccagctgcgtggaggggctctccccatactgccccccgctagtggcaacccaggccccactgcctggcacagctgctgacttctggctcatggtccatgagcagaaagtgtcagtcattgtcatgctggtttctgaggctgagatggagaagcaaaaagtggcacgctacttccccaccgagaggggccagcccatggtgcacggtgccctgagcctggcattgagcagcgtccgcagcaccgaaacccatgtggagcgcgtgctgagcctgcagttccgagaccagagcctcaagcgctctcttgtgcacctgcacttccccacttggcctgagttaggcctgcccgacagccccagcaacttgctgcgcttcatccaggaggtgcacgcacattacctgcatcagcggccgctgcacacgcccatcattgtgcactgcagctctggtgtgggccgcacgggagcctttgcactgctctatgcagctgtgcaggaggtggaggctgggaacggaatccctgagctgcctcagctggtgcggcgcatgcggcagcagagaaagcacatgctgcaggagaagctgcacctcaggttctgctatgaggcagtggtgagacacgtggagcaggtcctgcagcgccatggtgtgcctcctccatgcaaacccttggccagtgcaagcatcagccagaagaaccaccttcctcaggactcccaggacctggtcctcggtggggatgtgcccatcagctccatccaggccaccattgccaagctcagcattcggcctcctggggggttggagtccccggttgccagcttgccaggccctgcagagcccccaggcctcccgccagccagcctcccagagtctaccccaatcccatcttcctccccaccccccctttcctccccactacctgaggctccccagcctaaggaggagccgccagtgcctgaagcccccagctcggggcccccctcctcctccctggaattgctggcctccttgaccccagaggccttctccctggacagctccctgcggggcaaacagcggatgagcaagcataactttctgcaggcccataacgggcaagggctgcgggccacccggccctctgacgaccccctcagccttctggatccactctggacactcaacaagacctga
Sequence Length
1734
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
178,974 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase, non-receptor type 23, mRNA
NCBI Official Synonym Full Names
protein tyrosine phosphatase, non-receptor type 23
NCBI Official Symbol
PTPN23
NCBI Official Synonym Symbols
HDPTP; HD-PTP; PTP-TD14
NCBI Protein Information
tyrosine-protein phosphatase non-receptor type 23
UniProt Protein Name
Tyrosine-protein phosphatase non-receptor type 23
UniProt Gene Name
PTPN23
UniProt Synonym Gene Names
KIAA1471; HD-PTP; PTP-TD14
UniProt Entry Name
PTN23_HUMAN

NCBI Description

This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]

Uniprot Description

PTPN23: May act as a negative regulator of Ras-mediated mitogenic activity. Plays a role in ciliogenesis. Belongs to the protein-tyrosine phosphatase family. Non-receptor class subfamily.

Protein type: Motility/polarity/chemotaxis; EC 3.1.3.48; Protein phosphatase, tyrosine (non-receptor)

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: cytoplasm; early endosome; endosome; nucleoplasm; nucleus

Molecular Function: protein binding; protein kinase binding; protein tyrosine phosphatase activity

Biological Process: ubiquitin-dependent protein catabolic process via the multivesicular body pathway

Research Articles on PTPN23

Similar Products

Product Notes

The PTPN23 ptpn23 (Catalog #AAA1271329) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggccccc aggcagcccc tcttaccatt cgagggccct cgtctgctgg ccagtccacc cctagtcccc acctggtgcc ttcacctgcc ccatctccag ggcctggtcc ggtaccccct cgccccccag cagcagaacc acccccttgc ctgcgccgag gcgccgcagc tgcagacctg ctctcctcca gcccggagag ccagcatggc ggcactcagt ctcctggggg tgggcagccc ctgctgcagc ccaccaaggt ggatgcagct gagggtcgtc ggccgcaggc cctgcggctg attgagcggg acccctatga acatcctgag aggctgcggc agttgcagca ggagctggag gcctttcggg gtcagctggg ggatgtggga gctctggaca ctgtctggcg agagctgcaa gatgcgcagg aacatgatgc ccgaggccgt tccatcgcca ttgcccgctg ctactcactg aagaaccggc accaggatgt catgccctat gacagtaacc gtgtggtgct gcgctcaggc aaggatgact acatcaatgc cagctgcgtg gaggggctct ccccatactg ccccccgcta gtggcaaccc aggccccact gcctggcaca gctgctgact tctggctcat ggtccatgag cagaaagtgt cagtcattgt catgctggtt tctgaggctg agatggagaa gcaaaaagtg gcacgctact tccccaccga gaggggccag cccatggtgc acggtgccct gagcctggca ttgagcagcg tccgcagcac cgaaacccat gtggagcgcg tgctgagcct gcagttccga gaccagagcc tcaagcgctc tcttgtgcac ctgcacttcc ccacttggcc tgagttaggc ctgcccgaca gccccagcaa cttgctgcgc ttcatccagg aggtgcacgc acattacctg catcagcggc cgctgcacac gcccatcatt gtgcactgca gctctggtgt gggccgcacg ggagcctttg cactgctcta tgcagctgtg caggaggtgg aggctgggaa cggaatccct gagctgcctc agctggtgcg gcgcatgcgg cagcagagaa agcacatgct gcaggagaag ctgcacctca ggttctgcta tgaggcagtg gtgagacacg tggagcaggt cctgcagcgc catggtgtgc ctcctccatg caaacccttg gccagtgcaa gcatcagcca gaagaaccac cttcctcagg actcccagga cctggtcctc ggtggggatg tgcccatcag ctccatccag gccaccattg ccaagctcag cattcggcct cctggggggt tggagtcccc ggttgccagc ttgccaggcc ctgcagagcc cccaggcctc ccgccagcca gcctcccaga gtctacccca atcccatctt cctccccacc ccccctttcc tccccactac ctgaggctcc ccagcctaag gaggagccgc cagtgcctga agcccccagc tcggggcccc cctcctcctc cctggaattg ctggcctcct tgaccccaga ggccttctcc ctggacagct ccctgcgggg caaacagcgg atgagcaagc ataactttct gcaggcccat aacgggcaag ggctgcgggc cacccggccc tctgacgacc ccctcagcct tctggatcca ctctggacac tcaacaagac ctga. It is sometimes possible for the material contained within the vial of "PTPN23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.