Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTGR2 cdna clone

PTGR2 cDNA Clone

Gene Names
PTGR2; PGR2; ZADH1; HEL-S-298
Synonyms
PTGR2; PTGR2 cDNA Clone; PTGR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgattgttcaaagagtggtattgaattctcgacctggaaaaaatggtaatccagtggcagagaatttccgaatggaagaagtctatttaccagataatattaatgaaggacaagtacaagttagaactctttatctttctgtggatccttacatgcgttgtagaatgaatgaagacactggcactgattatataacaccttggcagctatctcaagtcgttgatggtggaggtattggaattatagaagaaagcaaacacacaaatttgactaaaggcgattttgtgacttctttctattggccctggcaaaccaaggttattctggatggaaatagccttgaaaaggtagacccacaacttgtggatggacacctttcatattttcttggagctataggtatgcctggtttgacttccttgattgggatacaggaaaaaggtcatataactgctggatctaataagacaatggttgtcagtggggccgcaggtgcctgtggatctgtggctgggcagattggccatttcttaggttgttccagagtggtgggaatttgtggaacacatgagaaatgcatcctcttgacctcagaactgggctttgatgctgcaattaattataaaaaagacaatgtggcagaacagctccgtgaatcatgcccagctggagtggatgtttattttgacaatgttggtggtaacatcagtgatacagtgataagtcagatgaatgagaacagccacatcatcctgtgtggtcaaatttctcagtacaacaaagatgtgccttatcctcccccgctatcccctgctatagaggcaatccagaaagaaagaaacatcacaagggaaagatttctggtattaaattataaagacaaatttgagcctggcattctacagctgagtcagtggtttaaagaaggaaagctaaagattaaagagacggtaataaatgggttggaaaacatgggagctgcattccagtccatgatgacaggaggtaacattggaaagcagatagtttgcatttcagaagaaatctctttgtaa
Sequence Length
1056
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,675 Da
NCBI Official Full Name
Homo sapiens prostaglandin reductase 2, mRNA
NCBI Official Synonym Full Names
prostaglandin reductase 2
NCBI Official Symbol
PTGR2
NCBI Official Synonym Symbols
PGR2; ZADH1; HEL-S-298
NCBI Protein Information
prostaglandin reductase 2
UniProt Protein Name
Prostaglandin reductase 2
Protein Family
UniProt Gene Name
PTGR2
UniProt Synonym Gene Names
ZADH1; PRG-2
UniProt Entry Name
PTGR2_HUMAN

NCBI Description

This gene encodes an enzyme involved in the metabolism of prostaglandins. The encoded protein catalyzes the NADPH-dependent conversion of 15-keto-prostaglandin E2 to 15-keto-13,14-dihydro-prostaglandin E2. This protein may also be involved in regulating activation of the peroxisome proliferator-activated receptor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]

Uniprot Description

PTGR2: Functions as 15-oxo-prostaglandin 13-reductase and acts on 15-keto-PGE1, 15-keto-PGE2, 15-keto-PGE1-alpha and 15-keto- PGE2-alpha with highest activity towards 15-keto-PGE2. Overexpression represses transcriptional activity of PPARG and inhibits adipocyte differentiation. Belongs to the NADP-dependent oxidoreductase L4BD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 1.3.1.48; Oxidoreductase

Chromosomal Location of Human Ortholog: 14q24.3

Molecular Function: 15-oxoprostaglandin 13-oxidase activity; zinc ion binding

Biological Process: prostaglandin metabolic process

Research Articles on PTGR2

Similar Products

Product Notes

The PTGR2 ptgr2 (Catalog #AAA1278624) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgttc aaagagtggt attgaattct cgacctggaa aaaatggtaa tccagtggca gagaatttcc gaatggaaga agtctattta ccagataata ttaatgaagg acaagtacaa gttagaactc tttatctttc tgtggatcct tacatgcgtt gtagaatgaa tgaagacact ggcactgatt atataacacc ttggcagcta tctcaagtcg ttgatggtgg aggtattgga attatagaag aaagcaaaca cacaaatttg actaaaggcg attttgtgac ttctttctat tggccctggc aaaccaaggt tattctggat ggaaatagcc ttgaaaaggt agacccacaa cttgtggatg gacacctttc atattttctt ggagctatag gtatgcctgg tttgacttcc ttgattggga tacaggaaaa aggtcatata actgctggat ctaataagac aatggttgtc agtggggccg caggtgcctg tggatctgtg gctgggcaga ttggccattt cttaggttgt tccagagtgg tgggaatttg tggaacacat gagaaatgca tcctcttgac ctcagaactg ggctttgatg ctgcaattaa ttataaaaaa gacaatgtgg cagaacagct ccgtgaatca tgcccagctg gagtggatgt ttattttgac aatgttggtg gtaacatcag tgatacagtg ataagtcaga tgaatgagaa cagccacatc atcctgtgtg gtcaaatttc tcagtacaac aaagatgtgc cttatcctcc cccgctatcc cctgctatag aggcaatcca gaaagaaaga aacatcacaa gggaaagatt tctggtatta aattataaag acaaatttga gcctggcatt ctacagctga gtcagtggtt taaagaagga aagctaaaga ttaaagagac ggtaataaat gggttggaaa acatgggagc tgcattccag tccatgatga caggaggtaa cattggaaag cagatagttt gcatttcaga agaaatctct ttgtaa. It is sometimes possible for the material contained within the vial of "PTGR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.