PTER cdna clone
PTER cDNA Clone
Gene Names
PTER; HPHRP; RPR-1
Synonyms
PTER; PTER cDNA Clone; PTER cdna clone
Sequence
atgtcttccttaagtggaaaagtccaaaccgttttgggccttgtagagccaagcaaactgggccgtaccctgacccatgaacacctggccatgacctttgactgctgttactgtccacctcccccgtgccaggaagctatttccaaagaacctatcgtgatgaaaaatttatattggattcagaaaaacgcctattcccataaagaaaaccttcaattaaatcaggagacagaagccataaaggaagaactgttgtattttaaagctaatggtggaggggctttggtggaaaacacaaccactgggattagccgagacacacagacgttgaagaggcttgcagaagagactggcgtccatatcatatctggagccgggttttatgtggatgcaactcactcctcagagaccagggccatgtcagtggagcagcttaccgatgtccttatgaatgaaattctccatggagctgatggaaccagtatcaagtgtggcattattggagaaattggttgctcctggcctttgactgagagtgaaagaaaggttctccaggccacagctcatgcccaggctcagcttggttgtcctgttattatccatcctggacggagctccagggcaccattccagattatccgaatattgcaagaagcaggcgcagacatctccaaaacagtcatgtcacacctggataggactattcttgataagaaagagctcttggagtttgctcagcttggctgctacttggaatatgatctctttggtactgaactacttcattaccaactcggcccagatattgacatgcctgatgataacaaaagaattagaagggtgcgtctcctggtggaagagggctgtgaagatcgaattctggtagcacatgacatacatacgaaaacccggctgatgaaatatggaggtcacggctattctcatatactcaccaatgttgttcctaaaatgttgctgagaggcataactgagaatgtgcttgataagattctaatagagaaccctaagcaatggctaactttcaaatag
Sequence Length
1050
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,436 Da
NCBI Official Full Name
Homo sapiens phosphotriesterase related, mRNA
NCBI Official Synonym Full Names
phosphotriesterase related
NCBI Official Symbol
PTER
NCBI Official Synonym Symbols
HPHRP; RPR-1
NCBI Protein Information
phosphotriesterase-related protein
UniProt Protein Name
Phosphotriesterase-related protein
Protein Family
UniProt Gene Name
PTER
UniProt Synonym Gene Names
hPHRP
UniProt Entry Name
PTER_HUMAN
Uniprot Description
PTER: Belongs to the phosphotriesterase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.1.-.-; Hydrolase
Chromosomal Location of Human Ortholog: 10p12
Biological Process: epithelial cell differentiation
Research Articles on PTER
Similar Products
Product Notes
The PTER pter (Catalog #AAA1269879) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcttcct taagtggaaa agtccaaacc gttttgggcc ttgtagagcc aagcaaactg ggccgtaccc tgacccatga acacctggcc atgacctttg actgctgtta ctgtccacct cccccgtgcc aggaagctat ttccaaagaa cctatcgtga tgaaaaattt atattggatt cagaaaaacg cctattccca taaagaaaac cttcaattaa atcaggagac agaagccata aaggaagaac tgttgtattt taaagctaat ggtggagggg ctttggtgga aaacacaacc actgggatta gccgagacac acagacgttg aagaggcttg cagaagagac tggcgtccat atcatatctg gagccgggtt ttatgtggat gcaactcact cctcagagac cagggccatg tcagtggagc agcttaccga tgtccttatg aatgaaattc tccatggagc tgatggaacc agtatcaagt gtggcattat tggagaaatt ggttgctcct ggcctttgac tgagagtgaa agaaaggttc tccaggccac agctcatgcc caggctcagc ttggttgtcc tgttattatc catcctggac ggagctccag ggcaccattc cagattatcc gaatattgca agaagcaggc gcagacatct ccaaaacagt catgtcacac ctggatagga ctattcttga taagaaagag ctcttggagt ttgctcagct tggctgctac ttggaatatg atctctttgg tactgaacta cttcattacc aactcggccc agatattgac atgcctgatg ataacaaaag aattagaagg gtgcgtctcc tggtggaaga gggctgtgaa gatcgaattc tggtagcaca tgacatacat acgaaaaccc ggctgatgaa atatggaggt cacggctatt ctcatatact caccaatgtt gttcctaaaa tgttgctgag aggcataact gagaatgtgc ttgataagat tctaatagag aaccctaagc aatggctaac tttcaaatag. It is sometimes possible for the material contained within the vial of "PTER, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
