Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTDSS1 cdna clone

PTDSS1 cDNA Clone

Gene Names
PTDSS1; LMHD; PSS1; PSSA
Synonyms
PTDSS1; PTDSS1 cDNA Clone; PTDSS1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtcctgcgtggggagccggaccctaagcaaggatgatgtgaactacaaaatgcatttccggatgatcaacgagcagcaagtggaggacatcaccattgacttcttctaccggccgcataccatcaccctgctcagcttcaccatcgtcagcctcatgtacttcgcctttaccagggatgactctgttccagaagacaacatctggagaggcatcctctctgttattttcttctttcttatcatcagtgtgttagctttccccaatggtccgttcactcgacctcatccagccttatggcgaatggtttttggactcagtgtgctctacttcctgttcctggtattcctactcttcctgaatttcgagcaggttaaatctctaatgtattggctagatccaaatcttcgatacgccacaagggaagcagatgtcatggagtatgctgtgaactgccatgtgatcacctgggagaggattatcagccactttgatatttttgcatttggacatttctggggctgggccatgaaggccttgctgatccgtagttacggtctctgctggacaatcagtattacctgggagctgactgagctcttcttcatgcatctcctccccaattttgccgagtgctggtgggatcaagtcattctggacatcctgttgtgcaatggcggtggcatttggctgggcatggtcgtttgccggtttttagagatgaggacttaccactgggcaagcttcaaggacattcataccaccaccgggaagatcaagagagctgttctgcagttcactcctgctagctggacctatgttcgatggtttgaccccaaatcttcttttcagagagtagctggagtgtaccttttcatgatcatctggcagctgactgagttgaataccttcttcttgaagcatatctttgtgttccaagccagtcatccattaagttggggtagaattctctttattggtggcatcacagctcccacagtgagacagtactacgcttacctcaccgacacacagtgcaagcgcgtaggaacacaatgctgggtgtttggggtcattggtttcctggaggccattgtttgcataaaatttggacaagatctcttctctaagacccaaatactctatgttgtgctttggcttctttgcgtggctttcaccactttcctctgtctgtacggcatgatttggtatgcagaacactatggtcaccgagaaaagacctactcggagtgtgaagatggcacctacagtccagagatctcctggcatcacaggaaagggacaaaaggttctgaagacagcccacccaagcatgcaggcaacaacgaaagccattcttccaggagaaggaatcggcattccaagtcaaaagtcaccaatggcgttggaaagaaatga
Sequence Length
1422
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,579 Da
NCBI Official Full Name
Homo sapiens phosphatidylserine synthase 1, mRNA
NCBI Official Synonym Full Names
phosphatidylserine synthase 1
NCBI Official Symbol
PTDSS1
NCBI Official Synonym Symbols
LMHD; PSS1; PSSA
NCBI Protein Information
phosphatidylserine synthase 1
UniProt Protein Name
Phosphatidylserine synthase 1
UniProt Gene Name
PTDSS1
UniProt Synonym Gene Names
KIAA0024; PSSA; PSS-1; PtdSer synthase 1
UniProt Entry Name
PTSS1_HUMAN

NCBI Description

The protein encoded by this gene catalyzes the formation of phosphatidylserine from either phosphatidylcholine or phosphatidylethanolamine. Phosphatidylserine localizes to the mitochondria-associated membrane of the endoplasmic reticulum, where it serves a structural role as well as a signaling role. Defects in this gene are a cause of Lenz-Majewski hyperostotic dwarfism. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]

Uniprot Description

PTDSS1: Catalyzes a base-exchange reaction in which the polar head group of phosphatidylethanolamine (PE) or phosphatidylcholine (PC) is replaced by L-serine. In membranes, PTDSS1 catalyzes mainly the conversion of phosphatidylcholine. Also converts, in vitro and to a lesser extent, phosphatidylethanolamine. Belongs to the phosphatidyl serine synthase family.

Protein type: EC 2.7.8.29; Transferase; Membrane protein, multi-pass; Mitochondrial; Membrane protein, integral; Lipid Metabolism - glycerophospholipid

Chromosomal Location of Human Ortholog: 8q22

Cellular Component: endoplasmic reticulum membrane; integral to membrane; membrane

Molecular Function: transferase activity

Biological Process: phosphatidylserine biosynthetic process; phospholipid biosynthetic process

Disease: Lenz-majewski Hyperostotic Dwarfism

Research Articles on PTDSS1

Similar Products

Product Notes

The PTDSS1 ptdss1 (Catalog #AAA1274880) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtcct gcgtggggag ccggacccta agcaaggatg atgtgaacta caaaatgcat ttccggatga tcaacgagca gcaagtggag gacatcacca ttgacttctt ctaccggccg cataccatca ccctgctcag cttcaccatc gtcagcctca tgtacttcgc ctttaccagg gatgactctg ttccagaaga caacatctgg agaggcatcc tctctgttat tttcttcttt cttatcatca gtgtgttagc tttccccaat ggtccgttca ctcgacctca tccagcctta tggcgaatgg tttttggact cagtgtgctc tacttcctgt tcctggtatt cctactcttc ctgaatttcg agcaggttaa atctctaatg tattggctag atccaaatct tcgatacgcc acaagggaag cagatgtcat ggagtatgct gtgaactgcc atgtgatcac ctgggagagg attatcagcc actttgatat ttttgcattt ggacatttct ggggctgggc catgaaggcc ttgctgatcc gtagttacgg tctctgctgg acaatcagta ttacctggga gctgactgag ctcttcttca tgcatctcct ccccaatttt gccgagtgct ggtgggatca agtcattctg gacatcctgt tgtgcaatgg cggtggcatt tggctgggca tggtcgtttg ccggttttta gagatgagga cttaccactg ggcaagcttc aaggacattc ataccaccac cgggaagatc aagagagctg ttctgcagtt cactcctgct agctggacct atgttcgatg gtttgacccc aaatcttctt ttcagagagt agctggagtg taccttttca tgatcatctg gcagctgact gagttgaata ccttcttctt gaagcatatc tttgtgttcc aagccagtca tccattaagt tggggtagaa ttctctttat tggtggcatc acagctccca cagtgagaca gtactacgct tacctcaccg acacacagtg caagcgcgta ggaacacaat gctgggtgtt tggggtcatt ggtttcctgg aggccattgt ttgcataaaa tttggacaag atctcttctc taagacccaa atactctatg ttgtgctttg gcttctttgc gtggctttca ccactttcct ctgtctgtac ggcatgattt ggtatgcaga acactatggt caccgagaaa agacctactc ggagtgtgaa gatggcacct acagtccaga gatctcctgg catcacagga aagggacaaa aggttctgaa gacagcccac ccaagcatgc aggcaacaac gaaagccatt cttccaggag aaggaatcgg cattccaagt caaaagtcac caatggcgtt ggaaagaaat ga. It is sometimes possible for the material contained within the vial of "PTDSS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.