Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTCH1 cdna clone

PTCH1 cDNA Clone

Gene Names
PTCH1; PTC; BCNS; HPE7; PTC1; PTCH; NBCCS; PTCH11
Synonyms
PTCH1; PTCH1 cDNA Clone; PTCH1 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaaggctactggccggaaagcgccgctgtggctgagagcgaagtttcagagactcttatttaaactgggttgttacattcaaaaaaactgcggcaagttcttggttgtgggcctcctcatatttggggccttcgcggtgggattaaaagcagcgaacctcgagaccaacgtggaggagctgtgggtggaagttggaggacgagtaagtcgtgaattaaattatactcgccagaagattggagaagaggctatgtttaatcctcaactcatgatacagacccctaaagaagaaggtgctaatgtcctgaccacagaagcgctcctacaacacctggactcggcactccaggccagccgtgtccatgtatacatgtacaacaggcagtggaaattggaacatttgtgttacaaatcaggagagcttatcacagaaacaggttacatggatcagataatagaatatctttacccttgtttgattattacacctttggactgcttctgggaaggggcgaaattacagtctgggacagcatacctcctgtaa
Sequence Length
552
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
144,356 Da
NCBI Official Full Name
Homo sapiens patched homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
patched 1
NCBI Official Symbol
PTCH1
NCBI Official Synonym Symbols
PTC; BCNS; HPE7; PTC1; PTCH; NBCCS; PTCH11
NCBI Protein Information
protein patched homolog 1
UniProt Protein Name
Protein patched homolog 1
UniProt Gene Name
PTCH1
UniProt Synonym Gene Names
PTCH; PTC; PTC1
UniProt Entry Name
PTC1_HUMAN

NCBI Description

This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]

Uniprot Description

PTCH1: a multi-pass membrane protein member of the ?patched? family that acts as a receptor for sonic hedgehog (SHH), indian hedgehog (IHH) and desert hedgehog (DHH). Associates with the smoothened protein (SMO) to transduce the hedgehog protein?s signal. Seems to have a tumor suppressor function, as inactivation of this protein is probably a necessary, if not sufficient step for tumorigenesis. Interacts with SNX17. Expressed in tumor cells but not in normal skin. In the embryo, found in all major target tissues of sonic hedgehog, such as the ventral neural tube, somites, and tissues surrounding the zone of polarizing activity of the limb bud. Defects in PTCH1 are the cause of basal cell nevus syndrome (BCNS), also known as Gorlin syndrome. BCNS is an autosomal dominant disease characterized by nevoid basal cell carcinomas and developmental abnormalities such as rib and craniofacial alterations, polydactyly, syndactyly, and spina bifida. In addition, the patients suffer from a multitude of tumors like basal cell carcinomas, fibromas of the ovaries and heart, cysts of the skin, jaws and mesentery, as well as medulloblastomas and meningiomas. PTCH1 defects is also the cause of holoprosencephaly, the most common structural anomaly of the brain, in which the developing forebrain fails to correctly separate into right and left hemispheres.

Protein type: Tumor suppressor; Cell cycle regulation; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 9q22.3

Cellular Component: caveola; Golgi apparatus; intracellular membrane-bound organelle; perinuclear region of cytoplasm; plasma membrane

Molecular Function: cholesterol binding; cyclin binding; protein binding; smoothened binding

Biological Process: brain development; dorsal/ventral pattern formation; embryonic limb morphogenesis; limb morphogenesis; negative regulation of multicellular organism growth; negative regulation of osteoblast differentiation; negative regulation of smoothened signaling pathway; negative regulation of transcription factor activity; negative regulation of transcription from RNA polymerase II promoter; neural plate pattern formation; neural tube patterning; organ morphogenesis; pharyngeal system development; protein processing; regulation of smoothened signaling pathway; smoothened signaling pathway

Disease: Basal Cell Carcinoma, Susceptibility To, 1; Basal Cell Nevus Syndrome; Holoprosencephaly 7

Research Articles on PTCH1

Similar Products

Product Notes

The PTCH1 ptch1 (Catalog #AAA1266566) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaagg ctactggccg gaaagcgccg ctgtggctga gagcgaagtt tcagagactc ttatttaaac tgggttgtta cattcaaaaa aactgcggca agttcttggt tgtgggcctc ctcatatttg gggccttcgc ggtgggatta aaagcagcga acctcgagac caacgtggag gagctgtggg tggaagttgg aggacgagta agtcgtgaat taaattatac tcgccagaag attggagaag aggctatgtt taatcctcaa ctcatgatac agacccctaa agaagaaggt gctaatgtcc tgaccacaga agcgctccta caacacctgg actcggcact ccaggccagc cgtgtccatg tatacatgta caacaggcag tggaaattgg aacatttgtg ttacaaatca ggagagctta tcacagaaac aggttacatg gatcagataa tagaatatct ttacccttgt ttgattatta cacctttgga ctgcttctgg gaaggggcga aattacagtc tgggacagca tacctcctgt aa. It is sometimes possible for the material contained within the vial of "PTCH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.