Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSTK cdna clone

PSTK cDNA Clone

Gene Names
PSTK; C10orf89
Synonyms
PSTK; PSTK cDNA Clone; PSTK cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaccgccgagaacatcagaggaaccggcagcgacgggccgcggaaacgaggcctctgcgtcctctgtggcctccccgcggcaggaaaatcgactttcgcgcgcgccctcgcccaccggctgcagcaggagcagggttgggccatcggtgttgtcgcgtatgatgacgtcatgcccgacgcgtttctcgccggggcaagagcgcgaccggcgccatcccaatggaaattgcttcgacaggaactgttgaagtacctggaatacttcttgatggctgtcattaatgggtgtcagatgtctgtcccacccaacaggactgaagccatgtgggaagattttataacctgcttaaaggatcaagatctgatattttctgcagcatttgaggcccagtcttgctacctcttaacaaaaactgctgtttctagacctttgtttttggttttggatgacaatttttattatcagagtatgagatatgaagtctaccagctggctcggaaatattcattgggcttttgccagctctttttagattgtcctcttgagacctgtttacagaggaatggccagaggccacaggcactgcctcctgagaccatccacctgatgcgaagaaagctagaaaagcccaaccctgagaaaaatgcttgggaacacaacagcctcacaattccgagtccagcatgtgcttcggaggccagcctggaagtgactgatttattgctcactgctttggaaaatccagtaaaatatgctgaggacaatatggaacaaaaggacacagacagaattatttgttcaactaacattcttcataaaactgatcagacactccgaaggattgtatctcagacaatgaaggaagcaaaaggtaatcaggaagccttctcagagatgacatttaagcaaagatgggtaagagcgaaccatgcagctatctggaggatcattctaggcaatgaacacatcaagtgcagaagcgcaaaggttggctggttgcagtgttgcagaatcgagaagaggccattgagcacggggtga
Sequence Length
1047
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,749 Da
NCBI Official Full Name
Homo sapiens phosphoseryl-tRNA kinase, mRNA
NCBI Official Synonym Full Names
phosphoseryl-tRNA kinase
NCBI Official Symbol
PSTK
NCBI Official Synonym Symbols
C10orf89
NCBI Protein Information
L-seryl-tRNA(Sec) kinase
UniProt Protein Name
L-seryl-tRNA(Sec) kinase
Protein Family
UniProt Gene Name
PSTK
UniProt Synonym Gene Names
C10orf89
UniProt Entry Name
PSTK_HUMAN

Uniprot Description

PSTK: Specifically phosphorylates seryl-tRNA(Sec) to O- phosphoseryl-tRNA(Sec), an activated intermediate for selenocysteine biosynthesis. Belongs to the L-seryl-tRNA(Sec) kinase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.7.1.164; Kinase, other; RNA-binding

Chromosomal Location of Human Ortholog: 10q26.13

Research Articles on PSTK

Similar Products

Product Notes

The PSTK pstk (Catalog #AAA1274099) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaccg ccgagaacat cagaggaacc ggcagcgacg ggccgcggaa acgaggcctc tgcgtcctct gtggcctccc cgcggcagga aaatcgactt tcgcgcgcgc cctcgcccac cggctgcagc aggagcaggg ttgggccatc ggtgttgtcg cgtatgatga cgtcatgccc gacgcgtttc tcgccggggc aagagcgcga ccggcgccat cccaatggaa attgcttcga caggaactgt tgaagtacct ggaatacttc ttgatggctg tcattaatgg gtgtcagatg tctgtcccac ccaacaggac tgaagccatg tgggaagatt ttataacctg cttaaaggat caagatctga tattttctgc agcatttgag gcccagtctt gctacctctt aacaaaaact gctgtttcta gacctttgtt tttggttttg gatgacaatt tttattatca gagtatgaga tatgaagtct accagctggc tcggaaatat tcattgggct tttgccagct ctttttagat tgtcctcttg agacctgttt acagaggaat ggccagaggc cacaggcact gcctcctgag accatccacc tgatgcgaag aaagctagaa aagcccaacc ctgagaaaaa tgcttgggaa cacaacagcc tcacaattcc gagtccagca tgtgcttcgg aggccagcct ggaagtgact gatttattgc tcactgcttt ggaaaatcca gtaaaatatg ctgaggacaa tatggaacaa aaggacacag acagaattat ttgttcaact aacattcttc ataaaactga tcagacactc cgaaggattg tatctcagac aatgaaggaa gcaaaaggta atcaggaagc cttctcagag atgacattta agcaaagatg ggtaagagcg aaccatgcag ctatctggag gatcattcta ggcaatgaac acatcaagtg cagaagcgca aaggttggct ggttgcagtg ttgcagaatc gagaagaggc cattgagcac ggggtga. It is sometimes possible for the material contained within the vial of "PSTK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.